ID: 1063236248

View in Genome Browser
Species Human (GRCh38)
Location 10:4119349-4119371
Sequence GACAAGGTTCATTCCATCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063236238_1063236248 17 Left 1063236238 10:4119309-4119331 CCTCCTAAGGCCACCCCTGTAAC No data
Right 1063236248 10:4119349-4119371 GACAAGGTTCATTCCATCGCTGG No data
1063236242_1063236248 4 Left 1063236242 10:4119322-4119344 CCCCTGTAACCAGTGCGAGGCTG No data
Right 1063236248 10:4119349-4119371 GACAAGGTTCATTCCATCGCTGG No data
1063236245_1063236248 -5 Left 1063236245 10:4119331-4119353 CCAGTGCGAGGCTGCCGAGACAA No data
Right 1063236248 10:4119349-4119371 GACAAGGTTCATTCCATCGCTGG No data
1063236244_1063236248 2 Left 1063236244 10:4119324-4119346 CCTGTAACCAGTGCGAGGCTGCC No data
Right 1063236248 10:4119349-4119371 GACAAGGTTCATTCCATCGCTGG No data
1063236237_1063236248 26 Left 1063236237 10:4119300-4119322 CCATCGCTTCCTCCTAAGGCCAC No data
Right 1063236248 10:4119349-4119371 GACAAGGTTCATTCCATCGCTGG No data
1063236240_1063236248 7 Left 1063236240 10:4119319-4119341 CCACCCCTGTAACCAGTGCGAGG No data
Right 1063236248 10:4119349-4119371 GACAAGGTTCATTCCATCGCTGG No data
1063236243_1063236248 3 Left 1063236243 10:4119323-4119345 CCCTGTAACCAGTGCGAGGCTGC No data
Right 1063236248 10:4119349-4119371 GACAAGGTTCATTCCATCGCTGG No data
1063236239_1063236248 14 Left 1063236239 10:4119312-4119334 CCTAAGGCCACCCCTGTAACCAG No data
Right 1063236248 10:4119349-4119371 GACAAGGTTCATTCCATCGCTGG No data
1063236235_1063236248 30 Left 1063236235 10:4119296-4119318 CCATCCATCGCTTCCTCCTAAGG No data
Right 1063236248 10:4119349-4119371 GACAAGGTTCATTCCATCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063236248 Original CRISPR GACAAGGTTCATTCCATCGC TGG Intergenic
No off target data available for this crispr