ID: 1063240251

View in Genome Browser
Species Human (GRCh38)
Location 10:4161902-4161924
Sequence GTGTTGGAAGAGAAGCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063240251_1063240259 12 Left 1063240251 10:4161902-4161924 CCACCAGGCTTCTCTTCCAACAC No data
Right 1063240259 10:4161937-4161959 ATTTGACATGAGATTTGGGTGGG 0: 415
1: 1612
2: 3815
3: 12769
4: 13727
1063240251_1063240257 8 Left 1063240251 10:4161902-4161924 CCACCAGGCTTCTCTTCCAACAC No data
Right 1063240257 10:4161933-4161955 TACAATTTGACATGAGATTTGGG 0: 612
1: 1782
2: 3943
3: 11854
4: 11858
1063240251_1063240256 7 Left 1063240251 10:4161902-4161924 CCACCAGGCTTCTCTTCCAACAC No data
Right 1063240256 10:4161932-4161954 TTACAATTTGACATGAGATTTGG 0: 686
1: 1872
2: 4005
3: 7573
4: 13640
1063240251_1063240258 11 Left 1063240251 10:4161902-4161924 CCACCAGGCTTCTCTTCCAACAC No data
Right 1063240258 10:4161936-4161958 AATTTGACATGAGATTTGGGTGG 0: 463
1: 1544
2: 3750
3: 12757
4: 15159
1063240251_1063240260 13 Left 1063240251 10:4161902-4161924 CCACCAGGCTTCTCTTCCAACAC No data
Right 1063240260 10:4161938-4161960 TTTGACATGAGATTTGGGTGGGG 0: 407
1: 1393
2: 3754
3: 12478
4: 14515

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063240251 Original CRISPR GTGTTGGAAGAGAAGCCTGG TGG (reversed) Intergenic
No off target data available for this crispr