ID: 1063240399

View in Genome Browser
Species Human (GRCh38)
Location 10:4163541-4163563
Sequence GGATACGGTTGTGCTGGAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063240399_1063240405 -1 Left 1063240399 10:4163541-4163563 CCCGTTCCAGCACAACCGTATCC No data
Right 1063240405 10:4163563-4163585 CATCATCTTCCTCATCCTCTGGG No data
1063240399_1063240404 -2 Left 1063240399 10:4163541-4163563 CCCGTTCCAGCACAACCGTATCC No data
Right 1063240404 10:4163562-4163584 CCATCATCTTCCTCATCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063240399 Original CRISPR GGATACGGTTGTGCTGGAAC GGG (reversed) Intergenic
No off target data available for this crispr