ID: 1063241450

View in Genome Browser
Species Human (GRCh38)
Location 10:4174172-4174194
Sequence CAGAGGAAAGTGTCTCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063241450_1063241458 28 Left 1063241450 10:4174172-4174194 CCTTCCTGAGACACTTTCCTCTG No data
Right 1063241458 10:4174223-4174245 ATTGCCATCCCGGACACTCATGG No data
1063241450_1063241456 18 Left 1063241450 10:4174172-4174194 CCTTCCTGAGACACTTTCCTCTG No data
Right 1063241456 10:4174213-4174235 TAGCCTAGTCATTGCCATCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063241450 Original CRISPR CAGAGGAAAGTGTCTCAGGA AGG (reversed) Intergenic
No off target data available for this crispr