ID: 1063241653

View in Genome Browser
Species Human (GRCh38)
Location 10:4175812-4175834
Sequence CAGGCCCACATGGAGGTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063241653_1063241665 22 Left 1063241653 10:4175812-4175834 CCACAGACCTCCATGTGGGCCTG No data
Right 1063241665 10:4175857-4175879 AAGGTAGGACAGGGAGATGAGGG No data
1063241653_1063241664 21 Left 1063241653 10:4175812-4175834 CCACAGACCTCCATGTGGGCCTG No data
Right 1063241664 10:4175856-4175878 GAAGGTAGGACAGGGAGATGAGG No data
1063241653_1063241661 13 Left 1063241653 10:4175812-4175834 CCACAGACCTCCATGTGGGCCTG No data
Right 1063241661 10:4175848-4175870 CACCCATAGAAGGTAGGACAGGG No data
1063241653_1063241660 12 Left 1063241653 10:4175812-4175834 CCACAGACCTCCATGTGGGCCTG No data
Right 1063241660 10:4175847-4175869 ACACCCATAGAAGGTAGGACAGG No data
1063241653_1063241657 3 Left 1063241653 10:4175812-4175834 CCACAGACCTCCATGTGGGCCTG No data
Right 1063241657 10:4175838-4175860 TGCAACCTTACACCCATAGAAGG No data
1063241653_1063241658 7 Left 1063241653 10:4175812-4175834 CCACAGACCTCCATGTGGGCCTG No data
Right 1063241658 10:4175842-4175864 ACCTTACACCCATAGAAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063241653 Original CRISPR CAGGCCCACATGGAGGTCTG TGG (reversed) Intergenic
No off target data available for this crispr