ID: 1063242756

View in Genome Browser
Species Human (GRCh38)
Location 10:4188212-4188234
Sequence GCTCTGGGACGGGAGAGCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063242747_1063242756 29 Left 1063242747 10:4188160-4188182 CCGCAGGCTCTCGGGGCTTGGTG No data
Right 1063242756 10:4188212-4188234 GCTCTGGGACGGGAGAGCTGCGG No data
1063242750_1063242756 -5 Left 1063242750 10:4188194-4188216 CCACACCTTGAGAAACAGGCTCT No data
Right 1063242756 10:4188212-4188234 GCTCTGGGACGGGAGAGCTGCGG No data
1063242753_1063242756 -10 Left 1063242753 10:4188199-4188221 CCTTGAGAAACAGGCTCTGGGAC No data
Right 1063242756 10:4188212-4188234 GCTCTGGGACGGGAGAGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063242756 Original CRISPR GCTCTGGGACGGGAGAGCTG CGG Intergenic
No off target data available for this crispr