ID: 1063242770

View in Genome Browser
Species Human (GRCh38)
Location 10:4188314-4188336
Sequence CGGGGTTCACAGGATGCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063242770_1063242782 29 Left 1063242770 10:4188314-4188336 CCCAAAGCATCCTGTGAACCCCG No data
Right 1063242782 10:4188366-4188388 TGTGAGCCTCGCCACGGGAGCGG No data
1063242770_1063242776 -4 Left 1063242770 10:4188314-4188336 CCCAAAGCATCCTGTGAACCCCG No data
Right 1063242776 10:4188333-4188355 CCCGAAATGGTGCGCCAAGATGG No data
1063242770_1063242783 30 Left 1063242770 10:4188314-4188336 CCCAAAGCATCCTGTGAACCCCG No data
Right 1063242783 10:4188367-4188389 GTGAGCCTCGCCACGGGAGCGGG No data
1063242770_1063242781 24 Left 1063242770 10:4188314-4188336 CCCAAAGCATCCTGTGAACCCCG No data
Right 1063242781 10:4188361-4188383 CAGTCTGTGAGCCTCGCCACGGG No data
1063242770_1063242780 23 Left 1063242770 10:4188314-4188336 CCCAAAGCATCCTGTGAACCCCG No data
Right 1063242780 10:4188360-4188382 ACAGTCTGTGAGCCTCGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063242770 Original CRISPR CGGGGTTCACAGGATGCTTT GGG (reversed) Intergenic
No off target data available for this crispr