ID: 1063244799

View in Genome Browser
Species Human (GRCh38)
Location 10:4206739-4206761
Sequence CGGGATGAGCAGAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 882
Summary {0: 1, 1: 0, 2: 3, 3: 68, 4: 810}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063244799 Original CRISPR CGGGATGAGCAGAAGGAGGA TGG (reversed) Intergenic
900100512 1:960276-960298 CCGGAGGAGGAGGAGGAGGAGGG + Intergenic
900354476 1:2253676-2253698 CGGTGCGAGCAGATGGAGGATGG + Intronic
900410422 1:2510149-2510171 CAGGATGACCTGCAGGAGGAGGG + Exonic
900641783 1:3691065-3691087 TGGGGTGAGCAGAGGTAGGAAGG + Intronic
900832187 1:4973261-4973283 AGGGATGAGAAGAAGAAGGCTGG - Intergenic
900932829 1:5747619-5747641 AGGGAGGAGCAGAGGGAGGGAGG + Intergenic
900932844 1:5747664-5747686 AGGGAGGAGGAGAGGGAGGAAGG + Intergenic
901034361 1:6327385-6327407 CGGCAGGAGCAGGAGGAGGAGGG - Exonic
901169543 1:7246628-7246650 AGGGATCAGAGGAAGGAGGAGGG - Intronic
901193444 1:7426094-7426116 TGGGACTAGCAGAAGGAGGGAGG - Intronic
901420325 1:9146338-9146360 CAGGAAGAGGAGGAGGAGGAAGG - Intergenic
902654826 1:17859961-17859983 AGGGAGGAGCAGGTGGAGGAAGG + Intergenic
902941232 1:19801354-19801376 GGAGATGAGCAGATGAAGGAAGG - Intergenic
903125108 1:21242497-21242519 TGGGCTGAACACAAGGAGGAGGG + Intronic
903684445 1:25120518-25120540 CGCCTTGTGCAGAAGGAGGAGGG - Intergenic
903788183 1:25875197-25875219 TGGGAGGAGCAGAAGGAGCACGG - Intergenic
904480250 1:30788842-30788864 TGTGCAGAGCAGAAGGAGGAGGG + Intergenic
904896534 1:33822261-33822283 GGGCATGAGGAGAAGGAGCAGGG + Intronic
905119797 1:35672861-35672883 CAGGATCATCAGAAGGAGGTGGG - Intergenic
905237817 1:36562181-36562203 GAGGAAGAGCAGAAGGAGGAAGG - Intergenic
905259551 1:36707872-36707894 GGGGAAGAGAAGATGGAGGAAGG - Intergenic
905380473 1:37558132-37558154 GGGGATGAGCAGATTGGGGAAGG - Intronic
906013955 1:42556223-42556245 AGAGAGGGGCAGAAGGAGGAGGG + Exonic
906114852 1:43349569-43349591 CGAGGTGAGCAGCAGGAGGCGGG - Intronic
906191973 1:43904758-43904780 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192010 1:43904899-43904921 CGGGAAGAGGAGCAGGAGGAGGG - Intronic
906192036 1:43904993-43905015 TGGGAAGAGGAGCAGGAGGAGGG - Intronic
906192093 1:43905205-43905227 CGGGAAGAGGAACAGGAGGAGGG - Intronic
906192196 1:43905574-43905596 CGGGAAGAGAAGCAGGAGGAGGG - Intronic
906192205 1:43905610-43905632 CGGGAAGAGAAGCAGGAGGAGGG - Intronic
906192214 1:43905646-43905668 CGGGAAGAGAAGCAGGAGGAGGG - Intronic
906192249 1:43905754-43905776 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192290 1:43905932-43905954 GGAGAGGAGCAGGAGGAGGAGGG - Intronic
906192337 1:43906081-43906103 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192381 1:43906225-43906247 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192433 1:43906438-43906460 GGAGAGGAGCAGGAGGAGGAGGG - Intronic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
906689684 1:47784414-47784436 GGGGCTGGGCAGAGGGAGGAGGG + Intronic
906713819 1:47952321-47952343 CTAGATGAGCAGAGGCAGGAGGG - Intronic
906745971 1:48222448-48222470 CCAGATGAGCAGGAGGAGAAAGG - Intergenic
907486879 1:54784177-54784199 AGGCATGAGCAGAGGGAGGTGGG + Intronic
907787286 1:57625240-57625262 CAGGAGTAGAAGAAGGAGGAGGG - Intronic
907839820 1:58145932-58145954 GAGGCTGAGGAGAAGGAGGAGGG - Intronic
907921591 1:58919202-58919224 AGGAGTGAGCAGAAGGAGAATGG + Intergenic
908309672 1:62867063-62867085 TGGGGTGGGCGGAAGGAGGAGGG - Intergenic
908792703 1:67798582-67798604 TAGGCTGAGGAGAAGGAGGAAGG - Intronic
909829070 1:80162590-80162612 AGGAAACAGCAGAAGGAGGATGG + Intergenic
910657456 1:89633145-89633167 CGCGAAGAGAAGTAGGAGGAAGG + Exonic
910760713 1:90728792-90728814 AGGGAGGAGGAGGAGGAGGAAGG + Intergenic
911530626 1:99039398-99039420 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
912723338 1:112038265-112038287 GGTGATGAGCAGAAAGATGAGGG - Intergenic
913975952 1:143455527-143455549 TGGGATGGGCAGAAGTAGGTCGG + Intergenic
914070349 1:144281149-144281171 TGGGATGGGCAGAAGTAGGTCGG + Intergenic
914108806 1:144685205-144685227 TGGGATGGGCAGAAGTAGGTCGG - Intergenic
914390271 1:147215001-147215023 CAGGATGATCAGAAGGCAGAAGG + Intronic
915482975 1:156199792-156199814 AGGGATGTGAAGAAGGAGGGTGG - Intronic
915645074 1:157264745-157264767 AGAGATGAACAGAATGAGGACGG + Intergenic
915727772 1:158030912-158030934 CAGGATGAGCAGATGGAGCTGGG - Intronic
915735436 1:158081734-158081756 AGGGATGAGCTCACGGAGGATGG + Intronic
915748496 1:158182988-158183010 CGGGGTGAGCAGGAGCAGCAGGG + Exonic
915755647 1:158256896-158256918 CGGGGTGAGCAGGAGCAGCAGGG + Exonic
915762525 1:158329516-158329538 CGGGGTGAGCAGGAGCAGCAGGG - Exonic
917383815 1:174446084-174446106 CAGGATGAGGAGGAGGAGTAGGG + Intronic
918023087 1:180714235-180714257 AAGGATGAGAAGGAGGAGGAAGG - Intronic
918434666 1:184499148-184499170 GGGGAAGAGGAGGAGGAGGAAGG - Intronic
919145886 1:193634371-193634393 AGGGAAGAGGAGAAGAAGGAAGG - Intergenic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919449341 1:197751886-197751908 AGGGAGGAGGAGGAGGAGGAGGG + Intronic
919919532 1:202160033-202160055 GGGGATGGGCAGGAGGAGGAAGG - Intronic
919988821 1:202694700-202694722 AAGGAAGAGGAGAAGGAGGAGGG - Intronic
920034663 1:203058195-203058217 CTGGCTGAGGAGGAGGAGGAGGG + Intronic
920042857 1:203114480-203114502 GGAGATGAGAAGAAGGAGGTTGG - Intronic
920199760 1:204252338-204252360 TGGGATGAGGAGGAAGAGGAAGG + Intronic
920776056 1:208938347-208938369 GAGGATGAGATGAAGGAGGAGGG - Intergenic
920912577 1:210232640-210232662 CGGCCTGAGCAGAGGGAGGGAGG + Intergenic
920986149 1:210891390-210891412 TGGGGTGAGGAGAAGGGGGAGGG + Intronic
920987053 1:210900834-210900856 TAGGTTGAGGAGAAGGAGGATGG - Intronic
921921284 1:220672910-220672932 AGGAAAGAGGAGAAGGAGGAGGG + Intergenic
922209497 1:223476717-223476739 AGAGAAGAGGAGAAGGAGGAGGG + Intergenic
922224418 1:223632929-223632951 CCAGATGGGAAGAAGGAGGAAGG - Intronic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
922879022 1:228965243-228965265 CAGGCTGAGGAGGAGGAGGATGG - Intergenic
923321170 1:232834993-232835015 TGGGATGAGGAGGAGGATGATGG - Intergenic
923342091 1:233016357-233016379 GGGGAGGAGGAGAAGGGGGAGGG - Intronic
923475302 1:234326086-234326108 AGGAAGGAGCAGGAGGAGGATGG + Intergenic
924585830 1:245360312-245360334 TGGGATGAGGATAAGGAGGATGG - Intronic
924611979 1:245580856-245580878 CAGCATGGGCAGAACGAGGAAGG - Intronic
1062763404 10:44667-44689 AGGGAAGAGGAGGAGGAGGAGGG - Intergenic
1062962172 10:1580743-1580765 AGGGAGGAACAGAAGGAGCATGG - Intronic
1062973101 10:1663423-1663445 AGGGATGAGCAGGCGGAGCACGG - Intronic
1063159443 10:3408707-3408729 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1063159481 10:3408849-3408871 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1063244799 10:4206739-4206761 CGGGATGAGCAGAAGGAGGATGG - Intergenic
1063295487 10:4800897-4800919 CAGGCTGTGCAGGAGGAGGATGG - Intronic
1063296240 10:4809672-4809694 CGGGATGAACAGACAGATGAAGG + Intronic
1063438121 10:6050787-6050809 CAGGACGAGGAGGAGGAGGATGG + Intronic
1064806233 10:19137194-19137216 AGGGATGAGTAGGAGGAGGGTGG + Intronic
1065188249 10:23189613-23189635 AGGGAGGAGGAGGAGGAGGAAGG + Intergenic
1066074081 10:31855000-31855022 GAGGAGGAGCAGGAGGAGGATGG + Intronic
1066615468 10:37289057-37289079 CAGGGTGAGCAGAAGCAGGATGG - Intronic
1068331450 10:55576358-55576380 CAGGCTGAGGAGAAAGAGGAAGG + Intronic
1068453612 10:57226407-57226429 CAGGAAGAGCAGAAGTAGGGAGG + Intergenic
1068638812 10:59378755-59378777 GAGGATGAGGGGAAGGAGGAAGG - Intergenic
1068649000 10:59500811-59500833 TGGGATGAGCAGAAGCATGTAGG + Intergenic
1069668746 10:70183624-70183646 GAGGAGGAGGAGAAGGAGGAAGG + Intergenic
1069893215 10:71664835-71664857 AGGGAGGAGGAGAAGGAAGAGGG - Intronic
1069913648 10:71774354-71774376 AGGGATGAGAAGAATTAGGAGGG - Intronic
1070243330 10:74705528-74705550 GGGGATGAGAAGGAGCAGGAAGG - Intronic
1070385633 10:75921836-75921858 AGGAAGGATCAGAAGGAGGAAGG - Intronic
1070771751 10:79086305-79086327 CGGGAGGAGGAGAAGGCTGAGGG - Intronic
1071382177 10:85077372-85077394 TGGGTTGAGGAGAAGGGGGAGGG + Intergenic
1071676407 10:87659790-87659812 CGGGAGGAGGAGTAGGAGAAGGG + Exonic
1071971897 10:90916061-90916083 CGGGTGGGGGAGAAGGAGGAGGG + Intronic
1072838018 10:98737557-98737579 TGGGGTGAGCAGAAGCAGGGTGG - Intronic
1073196290 10:101694680-101694702 CGGGAAGAGCACAGGGACGAGGG - Exonic
1073336514 10:102714289-102714311 CAGGAGGAGGAGGAGGAGGAGGG - Exonic
1073471849 10:103727444-103727466 CGGGATGGGCAGAAGGCAGGAGG + Intronic
1074874032 10:117600641-117600663 AGGGAGGAGGAGAAGGAGAAGGG - Intergenic
1075148045 10:119899998-119900020 CAGGAGGAGAAGCAGGAGGAAGG - Intronic
1075175387 10:120155855-120155877 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1075581928 10:123625392-123625414 GGAGATGAGGAGTAGGAGGAAGG + Intergenic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1076346038 10:129779872-129779894 CGGGAAGAGGAGAAGGGAGAGGG - Intergenic
1076685385 10:132196321-132196343 TAGGACGAGCAGAAGGATGAGGG - Intronic
1077184219 11:1229151-1229173 CGGGCTGCGCAAAAGGAGGTGGG - Exonic
1077192603 11:1261729-1261751 CGGGGTGGGCAGCAGGAGCACGG - Exonic
1077230529 11:1456474-1456496 GGGGAGGCGCAGAAGGAGAACGG + Exonic
1077392572 11:2306913-2306935 AGGGAGGAGGAGATGGAGGAGGG + Intronic
1077392580 11:2306935-2306957 GGGAAGGAGGAGAAGGAGGAGGG + Intronic
1077538213 11:3134516-3134538 AGGGACCAGCAGCAGGAGGAGGG - Intronic
1077887240 11:6395210-6395232 CAGCAGGGGCAGAAGGAGGAAGG - Exonic
1078059224 11:8032666-8032688 CGGGAGGTGCAAAGGGAGGAGGG - Intronic
1078659662 11:13277266-13277288 GGGGAGAAGAAGAAGGAGGAGGG + Intronic
1079079984 11:17407353-17407375 CAGGATGAGGAAGAGGAGGAAGG - Exonic
1079638262 11:22772724-22772746 AGAGATGAGTAGAAGGAGGGAGG + Intronic
1081626439 11:44658804-44658826 AGGGCTGAGCAGAGGGAGGGAGG + Intergenic
1082669795 11:56020878-56020900 GAGGAAGAGCAGGAGGAGGAGGG + Intergenic
1082887465 11:58102338-58102360 CAGAAAGAGCAGAAGGAGAAAGG - Intronic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1083431112 11:62613890-62613912 AGGGAGGAGGAGGAGGAGGAAGG - Intronic
1083541357 11:63513743-63513765 AGGGATGAGGTGAAGAAGGAGGG - Intronic
1083895775 11:65619031-65619053 CGGGGGGAGCTGCAGGAGGAAGG + Exonic
1084026666 11:66454787-66454809 AGGGAAGAGCAGACAGAGGAGGG - Intronic
1084145209 11:67261600-67261622 CGGGATGAGGATGAGGATGAGGG + Intergenic
1085410714 11:76288790-76288812 CGGGAGGAGCAGAGGAAGTAAGG + Intergenic
1085502703 11:77038077-77038099 GGGGATGAGGGGGAGGAGGAGGG + Intronic
1085705983 11:78787088-78787110 GGGGAGGAGCAGAAGAAGGGAGG + Intronic
1086078880 11:82882122-82882144 CAGGAGGAGGAGAAAGAGGAGGG + Intronic
1086426058 11:86683323-86683345 CAGGATGAGGGGAAAGAGGAAGG + Intergenic
1086825525 11:91490363-91490385 AGGAAGGAGCAGAAAGAGGAAGG - Intergenic
1087260267 11:96002935-96002957 GGGGATGATAAGAAGGATGATGG + Intronic
1088130600 11:106484634-106484656 CATGATGAGGAGAATGAGGATGG - Intergenic
1088691564 11:112333007-112333029 CTGGGGGAGCAGTAGGAGGAAGG - Intergenic
1089380897 11:118030695-118030717 AGGGCTGAGCAGGAAGAGGAAGG + Intergenic
1089386630 11:118072593-118072615 AGGGAGGAGAGGAAGGAGGAAGG + Intergenic
1089648878 11:119898957-119898979 TGGGATGGGCACAAGGACGAAGG - Intergenic
1090017317 11:123097749-123097771 CAGGAGGACAAGAAGGAGGAGGG + Intronic
1090465960 11:126933387-126933409 CGTGATGACTTGAAGGAGGAAGG - Intronic
1090827806 11:130400220-130400242 GGGGATGAGCTGGAGGAGCATGG + Intergenic
1091334202 11:134754344-134754366 CTGAATGAGCAGAAGGAGCAAGG - Intergenic
1091933692 12:4417667-4417689 CGGGAGGAGGAGCAGCAGGAGGG - Intergenic
1091992527 12:4967476-4967498 GAGGATGAGTAGAAGGAAGAGGG - Intergenic
1092231515 12:6778189-6778211 CGGAAGGAGGAGAAGGATGAAGG - Intronic
1092843337 12:12562943-12562965 CGGGAGGAGGAGGAGGAGGAGGG - Intergenic
1092910939 12:13144480-13144502 AGGGAGGAGGAGGAGGAGGAAGG + Intergenic
1093569056 12:20644832-20644854 GGGGAGGAGGAGGAGGAGGAGGG - Intronic
1095232136 12:39751902-39751924 TGGGATGGGGAGAAGGGGGAGGG + Intronic
1096046663 12:48568466-48568488 TGGGGTAAGGAGAAGGAGGATGG + Intronic
1096116894 12:49060249-49060271 CGGGGGGAGCAGAAGGTGGGGGG - Intergenic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1097616641 12:61891682-61891704 TAGGAGGAGGAGAAGGAGGAGGG + Intronic
1097983307 12:65756316-65756338 AGGGAAGAGAAGAAGGAGGAAGG - Intergenic
1098606544 12:72397558-72397580 AGGGGTGAGCACAAGGAGAATGG - Intronic
1098622072 12:72613758-72613780 GAGAAGGAGCAGAAGGAGGAGGG + Intronic
1099398453 12:82171015-82171037 GGGGAGGAGGAGGAGGAGGAAGG + Intergenic
1099611896 12:84883820-84883842 GGTGATTAGCAGAATGAGGAAGG + Intronic
1099637514 12:85233292-85233314 CTAGATAAGCAGAAGGAGAATGG + Intronic
1100550727 12:95644333-95644355 AGGAAGGAGAAGAAGGAGGAAGG - Intergenic
1100604889 12:96143529-96143551 AGGGCAGAGCAGAAAGAGGAAGG + Intergenic
1100689631 12:97025958-97025980 CGGCAGGGGCAGCAGGAGGAAGG - Intergenic
1101071220 12:101077885-101077907 CCGGATAAGCAAAAGAAGGAGGG - Intronic
1101654417 12:106707486-106707508 GGGGAGGAGCAGCAGAAGGAGGG + Intronic
1101706528 12:107225725-107225747 CGGGAGGAGGAGGGGGAGGAAGG + Intergenic
1101800048 12:108013826-108013848 CTGGAAGACCTGAAGGAGGAAGG - Intergenic
1102230355 12:111257588-111257610 AGTGAGGAGGAGAAGGAGGAGGG - Intronic
1102230406 12:111257776-111257798 CAGGAAGAGGAGGAGGAGGATGG - Intronic
1103205643 12:119126666-119126688 GTTGATGAGAAGAAGGAGGAAGG + Intronic
1103235383 12:119368192-119368214 GGGGAAGGGCAGGAGGAGGAGGG + Intronic
1103340758 12:120220001-120220023 TGGGAGGAGGAGAAGGAGGAAGG + Intronic
1103520695 12:121535821-121535843 GGGGCAGAGCTGAAGGAGGAGGG + Intronic
1103594926 12:122019084-122019106 AGGGATGAGGAGAAGGAGAGAGG - Intergenic
1103633499 12:122282957-122282979 CCGGATGAGCTGAAGTAGCACGG + Intronic
1104433072 12:128732524-128732546 CGGGGTGAGAAGAGGAAGGAGGG + Intergenic
1105289712 13:19044645-19044667 AGGGATGAGCAGGTGGAGCACGG + Intergenic
1106068482 13:26382087-26382109 AAGGAAGAGCAGAAGGAGTAAGG - Intronic
1106351717 13:28937075-28937097 AGTGATGCTCAGAAGGAGGAGGG + Intronic
1106378893 13:29216655-29216677 CAGGGTGAGCAGAAGCAGGGTGG - Intronic
1106485250 13:30166731-30166753 CTGGATGAGCAGGAGTAGGCGGG - Intergenic
1107015476 13:35705310-35705332 GGGCATGAGTAGAGGGAGGAAGG + Intergenic
1107473538 13:40713148-40713170 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1108426482 13:50306927-50306949 GGGGATTAGCAGAGGGAGGAAGG - Intronic
1108596193 13:51951692-51951714 GGGGATGAGGAGGAGGAGGAGGG + Intronic
1108729038 13:53213823-53213845 CGTCATAGGCAGAAGGAGGAAGG - Intergenic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1110860695 13:80341810-80341832 CGGGGGGAGAAGAAGGGGGAGGG + Intergenic
1110968689 13:81733369-81733391 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1111119774 13:83831554-83831576 AGGGAAGAAAAGAAGGAGGAAGG + Intergenic
1111622851 13:90746719-90746741 GAGGAAGAGGAGAAGGAGGAGGG - Intergenic
1111627873 13:90813046-90813068 CAGGATGAGCAAAAGCAGGGTGG + Intergenic
1112406965 13:99129818-99129840 TGGGCTGAGGAGGAGGAGGAAGG + Intergenic
1113218536 13:108071136-108071158 TGGGATGTGCAGAAGCAGGGAGG + Intergenic
1113220242 13:108092544-108092566 CTGTATGAGCAGAAGGGGGATGG - Intergenic
1113271270 13:108677129-108677151 GGGGATGTGCAGAAGGAGGAGGG + Intronic
1113955595 13:114098626-114098648 CGGGATGAGGGGAGGCAGGAAGG + Intronic
1114350637 14:21846760-21846782 TGGGACGAGCAGCAGGAGCATGG - Intergenic
1114354706 14:21894559-21894581 TGGGACGAGCAGCAGGAGCATGG - Intergenic
1114355434 14:21903075-21903097 TGGGATGAGCACCAGGAGCATGG - Intergenic
1114361507 14:21978677-21978699 TGGGACGAGCAGCAGGAGCATGG - Intergenic
1114450058 14:22819581-22819603 GGGGAAGTGCAGGAGGAGGATGG - Intronic
1114871791 14:26667155-26667177 TAGGAAGACCAGAAGGAGGAAGG - Intergenic
1116029181 14:39550342-39550364 CGGGGTGAGGGGAGGGAGGATGG - Intergenic
1116055220 14:39855453-39855475 AGTGATGAGGAGGAGGAGGAAGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117104184 14:52381982-52382004 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1117284504 14:54273887-54273909 TGGGGTGAGGAGAAGGGGGAGGG - Intergenic
1117832603 14:59767385-59767407 GGTGATGAGCAGAAGGAATATGG + Intronic
1118459559 14:65976053-65976075 GGGGAAGAGGAGAAGGGGGAAGG + Intronic
1118632468 14:67718291-67718313 AGGGAAGAGGAGAAGGAGGAAGG + Intronic
1118677150 14:68199636-68199658 CGGAATGAGATGAAGGAGGGAGG - Intronic
1118979104 14:70701716-70701738 GGGGGTGAGAAGAAAGAGGAAGG + Intergenic
1119090264 14:71774259-71774281 CTGCATGAGCACTAGGAGGATGG + Intergenic
1119119802 14:72064172-72064194 CTGGAAGAGGTGAAGGAGGAGGG + Intronic
1119556381 14:75556434-75556456 AGGGCTGAGCAGAATGAGCAAGG - Intergenic
1120137195 14:80884503-80884525 GTGGATGAGCAGAAGTAGGGTGG + Intronic
1120624964 14:86813768-86813790 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1120880811 14:89413979-89414001 GAGGAGGAGAAGAAGGAGGAGGG + Intronic
1121123207 14:91389306-91389328 CGGGAAGGCCAGGAGGAGGATGG - Intronic
1121662702 14:95647234-95647256 GTGGAGGAGTAGAAGGAGGAGGG + Intergenic
1121802918 14:96790119-96790141 AAGGATGAGCAGAAGGAGTAGGG + Intergenic
1121978124 14:98425094-98425116 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
1122076712 14:99239843-99239865 TGGAATAAACAGAAGGAGGAAGG + Intronic
1122299499 14:100723823-100723845 AGGGATGCGCAGATAGAGGAGGG + Intergenic
1122782672 14:104150206-104150228 GGGGAGGAGGAGGAGGAGGAGGG - Intronic
1202854589 14_GL000225v1_random:42750-42772 CGGCATGTGCAGAGAGAGGACGG - Intergenic
1123991601 15:25687618-25687640 CTGAATGAGGCGAAGGAGGATGG - Intronic
1124637440 15:31374036-31374058 AGGGCTGAGTAGAAGCAGGATGG - Exonic
1124696577 15:31869352-31869374 CTGGAGGAGGAGGAGGAGGATGG + Intronic
1124957841 15:34371151-34371173 GGGGAAGAGAAGGAGGAGGAAGG - Intergenic
1125511222 15:40293449-40293471 TGGGAAGAGGAGGAGGAGGAAGG + Intronic
1125612590 15:40981934-40981956 AGGGAGGAGAAGAATGAGGAAGG - Intronic
1125955665 15:43789345-43789367 TGGGATGACCTGAGGGAGGAGGG + Intronic
1126853568 15:52815439-52815461 TGGAATCAGCAGAAGGAGGGTGG - Intergenic
1127814191 15:62592091-62592113 GGGGATGTGTATAAGGAGGAGGG + Intronic
1128454546 15:67825348-67825370 GGGGGTGAGGAGAAGGAGGAGGG - Intronic
1128869821 15:71145864-71145886 GAGGAGGAGCAGGAGGAGGAGGG + Intronic
1129665324 15:77576353-77576375 GGGGAGGAGAAGGAGGAGGAGGG + Intergenic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129720140 15:77873422-77873444 AGGGAAGGGGAGAAGGAGGATGG - Intergenic
1129906803 15:79193461-79193483 GGGGATGAGCAGGAGGCTGATGG + Intergenic
1129969404 15:79764201-79764223 GGGAAGGACCAGAAGGAGGAAGG + Intergenic
1130226043 15:82058989-82059011 GGGGAGGAGGAGAAGGAGGGAGG - Intergenic
1130788161 15:87123252-87123274 GGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1130959877 15:88652508-88652530 GGGGAGGAGGGGAAGGAGGAGGG - Intronic
1131014192 15:89043665-89043687 AGGGAGGAGGAGAAGGAGGAGGG + Intergenic
1131017857 15:89072512-89072534 AAGGATGAGCAGGAGGGGGAGGG + Intergenic
1131739926 15:95377629-95377651 TGTGTTGAGCAGAAGGAGAAAGG - Intergenic
1132061129 15:98693217-98693239 CTGGATGAGCAGAATGAGGCAGG + Intronic
1132483441 16:177642-177664 CGGGAGGAGGGGATGGAGGAGGG + Intergenic
1132490116 16:223916-223938 CGGGAGGAGGAGGAGGAGGCGGG - Intronic
1132753437 16:1470034-1470056 GGGGCTGGGCAGCAGGAGGAAGG + Intronic
1133000532 16:2849160-2849182 CAGGACTAGAAGAAGGAGGAAGG + Intergenic
1133417290 16:5616550-5616572 AGGGAAGAGGAGGAGGAGGAGGG - Intergenic
1133417302 16:5616588-5616610 AGGGAAGAGGAGGAGGAGGAGGG - Intergenic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1133809827 16:9152826-9152848 AGGGGTGAGCAGAGGGAGGTGGG - Intergenic
1134449355 16:14354095-14354117 GGGGAGGGGCAGAGGGAGGAGGG + Intergenic
1134868225 16:17628147-17628169 CTGGGTGAGGAAAAGGAGGAAGG - Intergenic
1135547988 16:23378558-23378580 TTGGATGAGGAGCAGGAGGAAGG - Intronic
1135623903 16:23979034-23979056 TGGGGTGAGCAGAAGTAGGTAGG + Intronic
1136296901 16:29309002-29309024 AGGGATGGGCAGAGGGAGCACGG - Intergenic
1136521631 16:30800357-30800379 GGGGCTGGGCAGAAGCAGGAGGG + Intergenic
1136539905 16:30923521-30923543 GGGGAGGAGGAGGAGGAGGAGGG + Intronic
1137557056 16:49477296-49477318 GGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137557066 16:49477317-49477339 GGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137557081 16:49477347-49477369 GGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137557091 16:49477368-49477390 GGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1138126174 16:54440503-54440525 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
1138376068 16:56564931-56564953 TGGGAAGAGCAGGCGGAGGAGGG - Intergenic
1138529568 16:57627837-57627859 AGGAATGACCAGAAGGGGGATGG + Intronic
1139640874 16:68290608-68290630 AGGGAGGAGGAGAAGGATGAGGG - Intronic
1139642342 16:68301309-68301331 CTGGATGTGCAGAAGGAGTTCGG - Exonic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1139946330 16:70644909-70644931 AGGGAGGAGAAGGAGGAGGAAGG + Intronic
1140155803 16:72425787-72425809 CGGGAGGAGGAGAAGAAGAAGGG + Intergenic
1140199620 16:72884629-72884651 CAGGAGGAGGAGAAGGAGAAAGG + Intronic
1140234227 16:73144181-73144203 CGGGATCAGGACAAGGATGAGGG + Intronic
1140364881 16:74373664-74373686 GGTGATGAGCAGGAGGTGGAGGG - Intergenic
1140661035 16:77191474-77191496 AGGGATGTGCAGATGGAGGTCGG + Exonic
1140903546 16:79391914-79391936 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1141056851 16:80824811-80824833 AGGGAGGAAGAGAAGGAGGAAGG + Intergenic
1141530509 16:84643395-84643417 TGGGAGGAGGAGGAGGAGGAGGG - Intergenic
1141775666 16:86121449-86121471 AGGGAGGAGGAGAAGGAGGGAGG - Intergenic
1141775773 16:86121797-86121819 AGGGACAAGCAGGAGGAGGAAGG - Intergenic
1141775785 16:86121837-86121859 CGGGACAAGCAGGAGGAGGGAGG - Intergenic
1141775829 16:86121976-86121998 AGGGACAAGGAGAAGGAGGAGGG - Intergenic
1141817819 16:86425011-86425033 CAGGATGAACAGCAGCAGGAGGG + Intergenic
1141845133 16:86603444-86603466 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845144 16:86603501-86603523 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845155 16:86603558-86603580 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845166 16:86603615-86603637 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845177 16:86603672-86603694 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845188 16:86603729-86603751 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141972525 16:87493009-87493031 CGGGATCAGCAGAAGTGGGCGGG + Intergenic
1142058476 16:88015189-88015211 AGGGATGGGCAGAAGGAGCACGG - Intronic
1142160448 16:88554818-88554840 CGGGACCAGCGGAAGGAGTAGGG - Intergenic
1142305677 16:89283603-89283625 CGGGAGGAGCTGAAGGAGTGTGG - Exonic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1143391418 17:6561243-6561265 AAGGAAGAGGAGAAGGAGGAAGG - Intergenic
1143512988 17:7405979-7406001 AGGGATAGGGAGAAGGAGGAGGG + Intronic
1143525379 17:7468858-7468880 CTGGATGGGAAGAAGGAAGATGG + Intronic
1143759326 17:9089703-9089725 TGGGATGAGCAGAGGTAGAAGGG - Intronic
1144244189 17:13346747-13346769 AGCTATGAGAAGAAGGAGGATGG + Intergenic
1145238733 17:21227088-21227110 CGGAGTCAGAAGAAGGAGGATGG + Intergenic
1146534314 17:33637010-33637032 GGGGAGGAGAAGAAGGAGGAAGG - Intronic
1147034553 17:37670579-37670601 CGGGAGAAGCAGGAGGAGGGAGG + Intergenic
1147262182 17:39214995-39215017 CGGGATGAGCTGACCGAGGATGG - Exonic
1147674397 17:42194537-42194559 AGGGAGGAGCTGAAGGAGGGGGG + Intergenic
1148049184 17:44760763-44760785 TGGGCTGGGCAGAGGGAGGAAGG + Intronic
1148052372 17:44775551-44775573 CGGGAGGAGGGGAAGGAGGCGGG - Intronic
1148548344 17:48533630-48533652 CGGGATGAGGAAAAGGTGGAAGG - Intergenic
1148745204 17:49914208-49914230 AGGGCTGAGCAGCTGGAGGAGGG - Intergenic
1148759941 17:49994422-49994444 CGGGATGAGCTGAGAGAGGAAGG - Intronic
1149646505 17:58245284-58245306 GGGGTTAAGCTGAAGGAGGAGGG + Intronic
1149659907 17:58328830-58328852 GGGGAGGAGGAGGAGGAGGAGGG - Intergenic
1149664504 17:58356413-58356435 GGGGAAGAGTAGAAGGTGGAAGG + Intronic
1149723639 17:58870113-58870135 CTGGAGGAGGAGGAGGAGGAAGG + Intronic
1150006680 17:61474119-61474141 GGGGAGGATCAGAAGGATGATGG + Intronic
1150364843 17:64573177-64573199 GGGGAGGAGGAGGAGGAGGAGGG + Intronic
1150507542 17:65714990-65715012 CAGGTGGAGCAGAAGGAGCAAGG + Intronic
1150553378 17:66231437-66231459 TAGGATGAAAAGAAGGAGGAAGG - Intronic
1152000435 17:77641917-77641939 CAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1152266282 17:79296846-79296868 AGGGAGGAGAAGCAGGAGGAGGG - Intronic
1152302032 17:79500640-79500662 CGGGAAAAGGAGAAGGGGGATGG - Intronic
1152435388 17:80273297-80273319 GGGCAGGAGCTGAAGGAGGAAGG + Exonic
1152956313 18:44998-45020 AGGGAAGAGGAGGAGGAGGAGGG - Intergenic
1153040867 18:812197-812219 CGGGACGAGGAGGTGGAGGAGGG - Intronic
1153680639 18:7497346-7497368 AAGGAAGAGGAGAAGGAGGAAGG + Intergenic
1153732223 18:8025934-8025956 CAGGGAGAGCAGAAGGAGAAAGG + Intronic
1153836671 18:8969973-8969995 AGGAATGAGGAGAAGGAGGTTGG - Intergenic
1154031235 18:10756019-10756041 AGGGATGGGGATAAGGAGGAGGG + Intronic
1154494261 18:14944347-14944369 AGGGAAGAGCAGAGGGAGGGAGG - Intergenic
1155130830 18:22933282-22933304 CGCGATGGGCAGCTGGAGGAAGG + Intronic
1155161647 18:23201041-23201063 CAGGGAGAGCAGAAGCAGGAAGG + Intronic
1155553340 18:26990867-26990889 CCTGAAGAGCAGAAGGAGGAAGG - Intronic
1155670932 18:28370271-28370293 AGGCCTGAGCAGAAGGAAGAAGG + Intergenic
1156078182 18:33305742-33305764 AAGGAGGAGAAGAAGGAGGAGGG - Intronic
1156497002 18:37532266-37532288 CGGGATGTTCAGAAGAAGAAAGG - Intronic
1156585644 18:38428073-38428095 AGGGAAAAGGAGAAGGAGGAAGG + Intergenic
1157276069 18:46311896-46311918 GAGGAGGAGGAGAAGGAGGAAGG + Intergenic
1157312964 18:46566186-46566208 GGGGCTGAGGGGAAGGAGGAGGG - Intronic
1157316520 18:46594387-46594409 CTGGATGAGAAGAAAGCGGATGG - Intronic
1157470287 18:47983173-47983195 GGGGAGGAGAAGAAGGAGGAAGG - Intergenic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1157942005 18:51939489-51939511 CAGCATGAGCAGAGGCAGGATGG + Intergenic
1158882643 18:61795872-61795894 AGGGAAGAACAGAAGAAGGAAGG + Intergenic
1159002793 18:62988371-62988393 GGGGGTGTCCAGAAGGAGGACGG - Intergenic
1159833125 18:73303061-73303083 CAGGATGAGGAGGAGGATGAGGG - Intergenic
1159941797 18:74413939-74413961 CTAAATGAGCAGAAGGAGGCCGG - Intergenic
1160198899 18:76779885-76779907 CTGGCTGTGCAGATGGAGGAAGG + Intergenic
1160737930 19:673067-673089 CGGGATTTGGAGATGGAGGAAGG - Intergenic
1160870633 19:1276191-1276213 CGGGAAGATGAGAACGAGGACGG - Intronic
1160937955 19:1606186-1606208 CGGTGTGGGCAGAAGGAAGAGGG + Intergenic
1161207064 19:3046902-3046924 GGGGAGGAGGAGAGGGAGGAGGG - Intronic
1161619216 19:5289594-5289616 CGGCTGGAGCAGAGGGAGGAGGG - Intronic
1161837037 19:6654802-6654824 CAGGAGGAGGAGGAGGAGGATGG - Intergenic
1161921301 19:7268201-7268223 CGGCAGGTGCAGAAGGAGAAAGG + Intronic
1161957941 19:7506664-7506686 AGGGAGGAGCTGGAGGAGGACGG - Intronic
1161981703 19:7633426-7633448 CAGGAGGAGAAGACGGAGGAAGG - Exonic
1162053069 19:8046743-8046765 TGGGAAGAGAAGGAGGAGGAGGG - Intronic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1162918138 19:13885166-13885188 GGGGAGGAGAAGGAGGAGGAGGG + Intronic
1162922585 19:13912376-13912398 CCGGATGAGGATGAGGAGGAGGG + Exonic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1163594875 19:18215225-18215247 CAGGGTGTGCAGAATGAGGAAGG - Intronic
1163605634 19:18273836-18273858 GGGGATGAGAAGAAGGAACAGGG + Intronic
1163779448 19:19238935-19238957 ATGGATGAGCAGAAGGCAGAGGG - Intronic
1163779612 19:19239576-19239598 TGGGAGGAGGAGAGGGAGGAGGG - Intronic
1164292400 19:23880112-23880134 GGGAAAGAGAAGAAGGAGGAGGG + Intergenic
1164324661 19:24180861-24180883 GGAGATGAGAAAAAGGAGGAGGG + Intergenic
1164680384 19:30130699-30130721 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164680487 19:30131008-30131030 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164680513 19:30131081-30131103 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164680539 19:30131154-30131176 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164718701 19:30415250-30415272 CAGGAGGAGGAGAAGGGGGAGGG - Intronic
1164771934 19:30816223-30816245 AGGGAGGAAAAGAAGGAGGAAGG - Intergenic
1165112559 19:33510902-33510924 AGGGAAGAGCTGCAGGAGGAAGG - Intronic
1165203968 19:34168248-34168270 AGTGATGAGCATAAGGAGAACGG - Intergenic
1165254669 19:34568511-34568533 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1165355028 19:35299370-35299392 CGGGGTGACCAAGAGGAGGAAGG + Intronic
1165741992 19:38210233-38210255 CGGGAGGAGGAGAAGGAGGACGG - Intergenic
1165773084 19:38389499-38389521 CGGGAAGGGAAGAGGGAGGAAGG + Intronic
1165773201 19:38389971-38389993 AGGGATAAGCAGGAGGGGGAGGG + Intronic
1165802798 19:38563151-38563173 AGGGGTGAGCAGAAGGAAGCGGG - Intronic
1165927525 19:39336053-39336075 CGGGCTGTGCAGTAGGAGGAAGG + Exonic
1166085634 19:40472812-40472834 TGGGATGAGGAGGAGGGGGAAGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166192335 19:41183310-41183332 CAGGATGAGCAGTGGGATGAGGG + Intergenic
1167077418 19:47257892-47257914 CAGGATGAGCACAGGGAGGTGGG + Intronic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167285337 19:48596062-48596084 GGGGATGAGCTGGAGGGGGATGG + Intronic
1167295552 19:48646884-48646906 GGGGAGGAGGTGAAGGAGGAGGG + Intergenic
1167409487 19:49336663-49336685 GAGGAGGAGCTGAAGGAGGAAGG + Intronic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1167622036 19:50566072-50566094 AGGGAGGAGGAGGAGGAGGAAGG + Intronic
1167775656 19:51553039-51553061 GGGGAGGAGAAGGAGGAGGAGGG + Intergenic
1167779928 19:51592688-51592710 GGGGAGGAGGAGAAGGAGAAGGG + Intergenic
1167783379 19:51615529-51615551 TGGGGTGAGGAGAAGGAGAACGG + Intronic
1168107021 19:54171975-54171997 CTGGAGGAGGAGGAGGAGGATGG - Exonic
1168311982 19:55465068-55465090 TGGGCTGAGCAGAGGGAGGGAGG - Intergenic
1168348501 19:55662374-55662396 AGGGATGAGGGGAGGGAGGAGGG - Intronic
1168518742 19:57031695-57031717 CGGGGGCAGCAGAGGGAGGAAGG - Intergenic
925034238 2:673732-673754 AGGGAGGAGGAGGAGGAGGAGGG + Intronic
925142364 2:1558982-1559004 CGGGAAGAGCAGGGTGAGGAGGG + Intergenic
925148133 2:1594654-1594676 CGCGAAGAGCAGAATGAGAAGGG - Intergenic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925238231 2:2297730-2297752 CTGGGAGGGCAGAAGGAGGAGGG - Intronic
925553452 2:5101982-5102004 GGGGATTAGTAGAAGGAGAAGGG + Intergenic
925585725 2:5462097-5462119 CAGGATGAGCTGAAGGTGGGAGG + Intergenic
925606638 2:5666945-5666967 AGGGCTGAGCAGGGGGAGGAGGG - Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
925903869 2:8527592-8527614 CGAGAGGAGGTGAAGGAGGAAGG - Intergenic
926394847 2:12430403-12430425 AGGAAGGAGAAGAAGGAGGAAGG + Intergenic
926753639 2:16219281-16219303 GGGGAGGAACAGAAGGAGGAGGG - Intergenic
926884183 2:17582221-17582243 AGGGGTGAGGGGAAGGAGGAAGG + Intronic
926989195 2:18658899-18658921 AAGGATGAGGAGAAGGAGGAGGG + Intergenic
927612661 2:24557491-24557513 GAGGAGGAGCAGGAGGAGGAGGG - Intronic
928105834 2:28470076-28470098 GGGGAGGAGGAGAGGGAGGAGGG + Intronic
928418929 2:31122225-31122247 CGGGATAAGCAGAACGTGAAGGG + Intronic
929333625 2:40713249-40713271 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
929593196 2:43160067-43160089 AGGGAGGAGAAAAAGGAGGAGGG - Intergenic
929778265 2:44941960-44941982 AGGGGGGAGCAGGAGGAGGAGGG - Exonic
929868314 2:45736958-45736980 GGGAATGAGCAGATGGAAGAGGG + Intronic
930237435 2:48901527-48901549 CTGGATGGTCAGAAGGAGCAGGG - Intergenic
930364689 2:50424310-50424332 GGGGAGGAGGAGGAGGAGGAGGG + Intronic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931517246 2:63057202-63057224 GAGGAAGAGCAGAAGGGGGACGG - Exonic
931634476 2:64329192-64329214 CGGGAAACGCAGAAGCAGGAAGG - Intergenic
932578225 2:72974422-72974444 CTGGATGAGGGGAAGGAGGCTGG - Intronic
933196043 2:79391270-79391292 GAGGAGGAGGAGAAGGAGGAGGG - Intronic
933409682 2:81909891-81909913 CAGGATGTGCAAAAGGAGCATGG + Intergenic
933488368 2:82950819-82950841 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
934180650 2:89616509-89616531 TGGGATGGGCAGAAGTAGGTCGG + Intergenic
934535320 2:95128581-95128603 GAGGATGAGGAGGAGGAGGAGGG + Intronic
935171628 2:100614814-100614836 CGGGATGAGCATGAGGACTAGGG + Intergenic
935761292 2:106322959-106322981 GGGGAGGGGCAGGAGGAGGAGGG + Intergenic
936031874 2:109079152-109079174 GGGGAGGAGGAGGAGGAGGAGGG - Intergenic
936087717 2:109480625-109480647 TGGGAGGAGGAGGAGGAGGATGG + Intronic
936092898 2:109512327-109512349 GGGCATCAGAAGAAGGAGGAAGG - Intergenic
936427561 2:112434119-112434141 TGGGATGGGCAGATGGAGGCGGG - Intronic
936659240 2:114523805-114523827 TGGGATGAGCAGCAGGTGGAGGG - Intronic
937609739 2:123846414-123846436 AGGGATGACTAGAAGGAGGATGG + Intergenic
937920040 2:127122402-127122424 AGGGAGGAGCAGAAATAGGAGGG - Intergenic
937969108 2:127536033-127536055 GGGGCTGAGGAGGAGGAGGAGGG + Intronic
938463934 2:131514795-131514817 CAGGATGAGGAGCAGGTGGAAGG + Intergenic
939160098 2:138577271-138577293 CAGGAGGAGGAGGAGGAGGAGGG + Intergenic
940032096 2:149274391-149274413 AGGGATGAGGAGGAGAAGGAAGG - Intergenic
940488832 2:154330594-154330616 CTGGATAATCAGAAGGAGCAGGG - Intronic
940775027 2:157876122-157876144 CGGGGTGAAGAGGAGGAGGAAGG + Intergenic
940806641 2:158194879-158194901 GTGGATGAGCAGATGGGGGATGG - Intronic
940879186 2:158929449-158929471 AAGGATGAGCAGGAGGAGGAAGG - Intergenic
941318690 2:164027324-164027346 CAGGATGAAGAAAAGGAGGATGG + Intergenic
941623420 2:167804468-167804490 TGGGGTGGGCAGAAGGGGGAGGG - Intergenic
941684768 2:168437120-168437142 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942666519 2:178325133-178325155 AGGGATGGGCAGGAGTAGGATGG - Intronic
943228292 2:185209738-185209760 CCTGATTATCAGAAGGAGGAAGG + Intergenic
943811846 2:192196345-192196367 CGGGGGGAGAAGAAGGAGGAGGG - Intergenic
944094058 2:195946726-195946748 CCGGGTGAAGAGAAGGAGGAAGG - Intronic
946045297 2:216816036-216816058 AGGGAAGAAGAGAAGGAGGATGG - Intergenic
946427723 2:219608334-219608356 GGGAAGGAGGAGAAGGAGGAGGG + Exonic
947047882 2:226008851-226008873 AAGGAAGAGCAGACGGAGGAGGG + Intergenic
947119267 2:226799263-226799285 TGGGAGGAGGCGAAGGAGGAGGG - Exonic
947837735 2:233187812-233187834 AGGGAGGAGGAGCAGGAGGACGG - Intronic
947901095 2:233722941-233722963 TGGGCTGAGGAGGAGGAGGAAGG + Intronic
948169545 2:235890008-235890030 GGGGAAGAGCTGAAGGAGGCTGG - Intronic
948295237 2:236855663-236855685 CTGGCTGTGCAGATGGAGGAAGG - Intergenic
948342549 2:237266435-237266457 GGGGAGGAGGAGATGGAGGAGGG - Intergenic
948538971 2:238672223-238672245 GAGGAAGAGGAGAAGGAGGAGGG - Intergenic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
948995467 2:241576129-241576151 CGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1169208383 20:3752532-3752554 CAGGAGGAGCCGCAGGAGGAAGG + Exonic
1169214413 20:3785177-3785199 GGGGAGGAGGAGGAGGAGGAAGG - Exonic
1169244774 20:4016584-4016606 CAGGAGGGGCAGATGGAGGAGGG - Intergenic
1169325253 20:4670551-4670573 CAGGATGAGGAGGAGGAAGAGGG + Intergenic
1169474892 20:5922631-5922653 GAGGATGAGGAGGAGGAGGAGGG + Exonic
1170602436 20:17851130-17851152 TGGGCTGAGGAGGAGGAGGAAGG + Intergenic
1171210088 20:23310295-23310317 GTGGATGAGCTGAAGGAGAAAGG - Intergenic
1172077572 20:32310954-32310976 GGGGAAGAGGAGGAGGAGGAGGG + Exonic
1173437184 20:43043918-43043940 TGGGATAAGCAGACAGAGGAAGG - Intronic
1173549722 20:43924129-43924151 GGGGATGAGCATATGGAAGAGGG + Intronic
1174574343 20:51526071-51526093 CGGGCTGAGCAGATGCAGGAAGG - Intronic
1174655375 20:52167535-52167557 GGGGAAGAGGAGAAGGAGGGAGG - Intronic
1175311334 20:58013674-58013696 GGAGCTGAGCTGAAGGAGGAAGG + Intergenic
1175674563 20:60935622-60935644 AGGGAAGGGGAGAAGGAGGAAGG - Intergenic
1175764714 20:61584392-61584414 TGGGATGAGCAGAAAGGGCAGGG - Intronic
1175959238 20:62626635-62626657 CTGGAAGAGCAGGAGGGGGAGGG - Intergenic
1176057161 20:63154883-63154905 AGGGATGAGAAGAGGGAGAAGGG - Intergenic
1176097413 20:63350532-63350554 GGTGATGAGCAGCAGGAAGACGG + Exonic
1176141842 20:63548327-63548349 GGGGATGAGCACACGGAGAAGGG + Intronic
1176374670 21:6081085-6081107 TGGGATGGGCAGATGGAGGCGGG + Intergenic
1176720448 21:10388294-10388316 CAGGAGGAGAAGAAGAAGGAGGG + Intergenic
1177688906 21:24477499-24477521 TGGGATGAGGAGATGGGGGAGGG + Intergenic
1178285490 21:31322269-31322291 CAGGAGGAGAAGAAGGAGCAAGG - Intronic
1179554498 21:42163590-42163612 CTGGATGAGGGGGAGGAGGAGGG + Intergenic
1179748805 21:43457160-43457182 TGGGATGGGCAGATGGAGGCGGG - Intergenic
1180228858 21:46414418-46414440 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
1180301652 22:11041143-11041165 CAGGAGGAGAAGAAGAAGGAGGG + Intergenic
1181323029 22:22023185-22023207 CGGAATGAGCAGGAGGGCGATGG + Intergenic
1181704968 22:24644489-24644511 TGGGAGGGGCAGAGGGAGGAGGG + Intergenic
1182597613 22:31434215-31434237 TGGGATGGGCTGAATGAGGAAGG + Exonic
1183328432 22:37206731-37206753 GAGGATGAGGAGGAGGAGGATGG - Exonic
1183613053 22:38923682-38923704 AGGGAGGAGAGGAAGGAGGAAGG - Intergenic
1183758150 22:39790073-39790095 CTGAATGTGCAGAAGGAGAAGGG + Intronic
1184883819 22:47329815-47329837 GAAGAGGAGCAGAAGGAGGAAGG + Intergenic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185121418 22:48973879-48973901 CTGGAAGAGCAGTAGGAGGGAGG - Intergenic
1185301232 22:50082142-50082164 CGGGACCAGCTGAAGCAGGAGGG + Intronic
949667632 3:6358703-6358725 CAGGAAGAGAAGAAGGAGAAAGG - Intergenic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
950174488 3:10863238-10863260 AGGGCTAAGTAGAAGGAGGAAGG + Intronic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
950565459 3:13767289-13767311 CGGGATTAGAGGAAGCAGGAGGG - Intergenic
950618090 3:14178465-14178487 CGGCGTGAGGAGGAGGAGGAGGG - Exonic
950626140 3:14248540-14248562 TGGGCTGAGCAGAATGAGAACGG - Intergenic
950841660 3:15973949-15973971 GAGGAAGAGGAGAAGGAGGAAGG - Intergenic
950905055 3:16530519-16530541 AGGGAAGAAGAGAAGGAGGAGGG - Intergenic
951485406 3:23203671-23203693 GGGGATGGGAAGAAGGGGGAGGG - Intronic
951676521 3:25247616-25247638 GAGGATGAGCAGAAGCAGGGTGG - Intronic
951964986 3:28372024-28372046 CAGGAAGAGAAGGAGGAGGAGGG - Intronic
952262549 3:31754389-31754411 CAAGATGAGCGGAAGGAAGAGGG + Intronic
953430498 3:42835882-42835904 TCGGGTGGGCAGAAGGAGGAAGG - Intronic
953592211 3:44269348-44269370 AGGGAGGAGAAGGAGGAGGAGGG - Intronic
953868978 3:46609755-46609777 CGGGGTGGGCAGAGGGAGCAGGG + Intronic
954550885 3:51480668-51480690 CAGGATGAGAAAAAGGAGGATGG - Intronic
955406631 3:58629850-58629872 AGAGAGGAGGAGAAGGAGGATGG + Intergenic
956440904 3:69279690-69279712 GGGGAAGAGGAGAAGGAGGAGGG - Intronic
956440915 3:69279721-69279743 GGGGAAGAGGAGAAGGAGGAGGG - Intronic
956440926 3:69279752-69279774 GGGGAGGAGGAGAAGGAGGAGGG - Intronic
956784427 3:72630576-72630598 GGGGAGAAGCAGAAGGAAGAAGG + Intergenic
957875028 3:86133437-86133459 TGGGATGAGGGGAAGGGGGAGGG + Intergenic
958163667 3:89851431-89851453 AGGGGAGAGGAGAAGGAGGAAGG + Intergenic
958989990 3:100831705-100831727 CTGGATGAGTAGAGGGATGAGGG - Intronic
960183771 3:114613986-114614008 AAGGATGAGGAGAAGGAGGTGGG - Intronic
961531896 3:127545030-127545052 CTGGGTGAGCAGGAAGAGGAAGG + Intergenic
961824776 3:129593259-129593281 CGGGTGGGGCAGAGGGAGGAGGG - Intronic
962203425 3:133417279-133417301 AGGGGTGAGCAGAAGGGAGAGGG - Intronic
962536099 3:136329829-136329851 CAGGCTGAGCAGAAGGTTGAGGG + Intronic
962606312 3:137035499-137035521 TGGGATCAGCAGAAGGCGGGGGG + Intergenic
962769699 3:138600926-138600948 GGGGAGGAGGAGAAGGAGGGAGG + Intergenic
964004487 3:151811668-151811690 AGGGATGAGGAGAGGGCGGAGGG - Intergenic
964452676 3:156826639-156826661 CCGGAAGAGGAGGAGGAGGAGGG - Exonic
964774512 3:160261151-160261173 AGGAATGAGAAGAAGAAGGATGG - Intronic
965079751 3:164021049-164021071 AAGGATGAGGAGAAGGCGGAGGG + Intergenic
965511024 3:169568065-169568087 GAGGGTGAGCAGAAGCAGGATGG + Intronic
966384543 3:179382212-179382234 TGGGATGGGAGGAAGGAGGAGGG - Intronic
966521915 3:180882423-180882445 GAGGAGGAGGAGAAGGAGGAAGG - Intronic
966711876 3:182980303-182980325 CGGGAAGGGGCGAAGGAGGAAGG + Intronic
967332820 3:188308966-188308988 AGGGAGGAGGAGAAGGAGAAAGG - Intronic
967826993 3:193884924-193884946 CGGGTGGAGGAGAAGGAGTAGGG + Intergenic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
968236705 3:197035784-197035806 GGGGATGGGCGGGAGGAGGACGG + Intergenic
968263525 3:197344066-197344088 CGGGATGAGTAGAGGAAAGAAGG - Intergenic
968293294 3:197555247-197555269 CCGGAGGAGGAGGAGGAGGAGGG + Intronic
968612309 4:1562865-1562887 AGGGCCGAGCAGAAGGAGGGTGG + Intergenic
968671278 4:1853109-1853131 GGGGAGGAGCAGAATGAGGAGGG - Intronic
968914350 4:3490741-3490763 AGGAATGAGCAGGAGGAAGAAGG - Intronic
969233889 4:5851694-5851716 AGGGAGGAGAAGGAGGAGGAAGG + Intronic
969304746 4:6319147-6319169 CTGGATGTGAAGATGGAGGAGGG - Intergenic
969454702 4:7294667-7294689 GGGGAGGAGGAGGAGGAGGAGGG - Intronic
969526052 4:7704648-7704670 GGGGCTGAGCAGAAGGAAGCCGG - Intronic
969607827 4:8211273-8211295 CGGGAGGGGGAGAAGGAGGGAGG - Intronic
969607839 4:8211306-8211328 CGGGAGGGGGAGAAGGAGGGAGG - Intronic
969631791 4:8343254-8343276 CTGGATGAGGAGAAGCAGGGAGG + Intergenic
969838137 4:9860165-9860187 AGGGAGGAGAAGGAGGAGGAAGG - Intronic
969979534 4:11140494-11140516 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
970004700 4:11399568-11399590 CAGGATGAGCAGCAGCCGGATGG + Exonic
970326833 4:14934513-14934535 CAGGCTGAGGAGGAGGAGGACGG + Intergenic
970382932 4:15526101-15526123 TGGGATGTGCAGAGGGAGGTAGG - Intronic
970506730 4:16738384-16738406 CAGGAAGAGGAGGAGGAGGAAGG + Intronic
971574540 4:28256593-28256615 AGGGAGGAGGAGGAGGAGGAGGG - Intergenic
972541575 4:40043701-40043723 CGGCAGGAGCAGGAGGAGGAGGG - Intergenic
972990497 4:44817683-44817705 GAGGAAGAGGAGAAGGAGGAAGG + Intergenic
973156484 4:46961335-46961357 CGGGAGGAGGATGAGGAGGATGG - Intronic
974020473 4:56688086-56688108 GAGGATGAGGAGAAGAAGGAAGG + Intergenic
974094722 4:57350910-57350932 GGTGATGAGCAGAAGGGTGAGGG + Intergenic
974389624 4:61249429-61249451 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
974735543 4:65927088-65927110 TGGGATGAGGGGAAGCAGGAGGG - Intergenic
975319537 4:72994742-72994764 AGGGAGGAAGAGAAGGAGGAGGG - Intergenic
975466418 4:74714252-74714274 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
975497856 4:75054327-75054349 ATGGATGTTCAGAAGGAGGATGG - Intergenic
975510841 4:75192761-75192783 TGGAGGGAGCAGAAGGAGGAAGG - Intergenic
975986443 4:80204968-80204990 AGGGAAGAGTAGAAAGAGGAGGG - Intergenic
977359315 4:95982674-95982696 TGGGCAGAGCAGAAGGATGAAGG + Intergenic
977666982 4:99653641-99653663 GGGGAGGAGGAAAAGGAGGAGGG - Exonic
977990980 4:103442304-103442326 GGGGAAGAGGAGAAGGGGGAAGG - Intergenic
979481094 4:121218593-121218615 AGGGACGGGGAGAAGGAGGAAGG - Intronic
979927364 4:126583669-126583691 CTGGCTGAGCAGAAGCAGAAGGG - Intergenic
981288656 4:143048494-143048516 TGAGAGGAGGAGAAGGAGGAAGG - Intergenic
981616086 4:146646469-146646491 AGGGAGGAAGAGAAGGAGGAAGG - Intergenic
982742612 4:159073625-159073647 CTGGATTAGGAGAGGGAGGATGG - Intergenic
983919821 4:173333856-173333878 CGGGAGGAGGAGGAGGAGGAGGG - Intronic
984237555 4:177179060-177179082 CAGGAAGAGCAGATGGAAGATGG - Intergenic
984687365 4:182685217-182685239 AGGGAAGAAGAGAAGGAGGAAGG - Intronic
984703430 4:182833006-182833028 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703447 4:182833055-182833077 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703483 4:182833155-182833177 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703489 4:182833174-182833196 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703505 4:182833227-182833249 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703523 4:182833278-182833300 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703561 4:182833376-182833398 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703567 4:182833395-182833417 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703578 4:182833430-182833452 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703627 4:182833556-182833578 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703633 4:182833575-182833597 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703639 4:182833594-182833616 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703650 4:182833629-182833651 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703699 4:182833755-182833777 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703705 4:182833774-182833796 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703711 4:182833793-182833815 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703724 4:182833832-182833854 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703730 4:182833851-182833873 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703744 4:182833889-182833911 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703755 4:182833924-182833946 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703768 4:182833959-182833981 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703774 4:182833978-182834000 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703780 4:182833997-182834019 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703800 4:182834048-182834070 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703837 4:182834145-182834167 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703843 4:182834164-182834186 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703849 4:182834183-182834205 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703855 4:182834202-182834224 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703866 4:182834237-182834259 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703915 4:182834363-182834385 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703921 4:182834382-182834404 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703927 4:182834401-182834423 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703933 4:182834420-182834442 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703939 4:182834439-182834461 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703952 4:182834478-182834500 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703958 4:182834497-182834519 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703964 4:182834516-182834538 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703970 4:182834535-182834557 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703976 4:182834554-182834576 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
985177285 4:187215238-187215260 GGAGAGGAGGAGAAGGAGGAAGG - Intergenic
985440433 4:189979843-189979865 AGGGAAGAGGAGGAGGAGGAGGG - Intergenic
985487126 5:158192-158214 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985487145 5:158233-158255 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985487236 5:158510-158532 TGGGATGGGCAGAGGGAGGAGGG - Intronic
985487255 5:158552-158574 CAGGACGGGCAGAGGGAGGAGGG - Intronic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985818163 5:2141937-2141959 GCGGATGAGCAGATGGAGGCAGG + Intergenic
985950680 5:3219508-3219530 CCTGATGAGCAGGAGGAGGTGGG + Intergenic
985985596 5:3513461-3513483 CGGGAGAGGCAGAAGGAGAAGGG + Intergenic
986465639 5:8019999-8020021 AGTGCTGAGCAAAAGGAGGAAGG - Intergenic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
988042844 5:25910939-25910961 CAGGATGAGCAGGATGAGAATGG + Intergenic
988494375 5:31732498-31732520 AAGGCTGAGCAGAAGGAGGTGGG + Intronic
988970712 5:36465105-36465127 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
989322359 5:40151199-40151221 CTGGAGGAGCAAAAGGAAGAAGG - Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990184216 5:53195736-53195758 AGGGAAGAGTAGAAGCAGGAAGG + Intergenic
990330368 5:54719653-54719675 TGGGCTGAGCAGCAGGAGGTGGG + Intergenic
990708654 5:58558374-58558396 CTTGATCAGAAGAAGGAGGAAGG - Intergenic
991601368 5:68354564-68354586 CTGGATGAGAGGAAGGAGGTAGG - Intergenic
992134893 5:73734351-73734373 TGGGATGAGCAGAAGGGCCAGGG + Intronic
992368379 5:76116465-76116487 TGGGAAGAGCAGAAGGCAGAGGG - Intronic
992483782 5:77176502-77176524 GGGCATGAGCAGGAGGAGGGTGG + Intergenic
993021136 5:82592477-82592499 GAGGAGGAGGAGAAGGAGGAAGG - Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
995548209 5:113253575-113253597 GCAGATGAGCACAAGGAGGAGGG + Intronic
996034585 5:118744002-118744024 AGGGAAGAAGAGAAGGAGGAAGG + Intergenic
996426701 5:123320609-123320631 GAGGATGAGCAGAAGAAGGGTGG - Intergenic
996595622 5:125199355-125199377 GGGGAGGAGAAGATGGAGGAGGG - Intergenic
996699435 5:126435471-126435493 CAGGGAGAGCAGAAGGGGGAAGG + Intronic
996938709 5:128977521-128977543 GGGAATGAGCAGGAGGAGAAAGG + Intronic
997737993 5:136228557-136228579 CGGGATGAGCAGAATGGAGCAGG + Intronic
998783491 5:145684104-145684126 GGGGAAGAGCAGGAGGGGGAAGG + Intronic
999137219 5:149329952-149329974 GAGGAGGAGGAGAAGGAGGAGGG - Intronic
999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG + Intergenic
1000313270 5:160064876-160064898 AGGAATGAACAGAAGCAGGAAGG - Intronic
1000747655 5:165055053-165055075 GAGGAGGAGTAGAAGGAGGAAGG - Intergenic
1001132958 5:169079713-169079735 AGGGAAGAGGAGGAGGAGGAGGG + Intronic
1001600113 5:172923131-172923153 TGGGAGGAGGAGGAGGAGGAGGG + Intronic
1001600127 5:172923190-172923212 TGGGAGGAGGAGGAGGAGGAGGG + Intronic
1001894732 5:175368492-175368514 TGGGATGCCCAGAAGAAGGAGGG - Intergenic
1002288981 5:178187076-178187098 AGGGAGGAGCATGAGGAGGAGGG - Intergenic
1002715486 5:181224180-181224202 CGGGAGGAGGAGGAGGAGGACGG + Exonic
1002925325 6:1602399-1602421 AGGGATGGGCAGCAGGAGGTGGG - Intergenic
1003479653 6:6519304-6519326 AGGGAAGAGCCGAAGGAGTAAGG - Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003872779 6:10415113-10415135 GTGGAGGAGGAGAAGGAGGAGGG + Exonic
1004698799 6:18059177-18059199 GAGGATGAGCAAGAGGAGGAAGG - Intergenic
1004703897 6:18104829-18104851 CGAGAAGAGCAGGAGCAGGAAGG + Intergenic
1005081954 6:21965396-21965418 GAGGAGGAGAAGAAGGAGGAGGG - Intergenic
1005091506 6:22061692-22061714 GGGCAGGAGCAGATGGAGGAAGG - Intergenic
1005500138 6:26422159-26422181 CAGGCTGAGGAGGAGGAGGAGGG - Intergenic
1006361173 6:33588236-33588258 GGGGATGAGAAGAAGGAGGAGGG - Intergenic
1006387484 6:33739410-33739432 GGGAAGGGGCAGAAGGAGGAGGG + Intronic
1007814337 6:44509865-44509887 GGGGATGAGCCTCAGGAGGAAGG + Intergenic
1007827105 6:44608762-44608784 GAGGAGGAGGAGAAGGAGGATGG - Intergenic
1007962204 6:45970069-45970091 GGGGGTGAGGAGAGGGAGGAAGG - Intronic
1008407676 6:51136734-51136756 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
1010982075 6:82379566-82379588 CGGGTAGAGGAGAAGCAGGAGGG - Intergenic
1011753117 6:90473103-90473125 TGGGCTGAGCAGAAGGAAGAGGG - Intergenic
1011854299 6:91669601-91669623 CAGGAGGAGCAGAAAGAAGAGGG - Intergenic
1012083159 6:94785735-94785757 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1012258378 6:97060381-97060403 GAGGATGAGCTGAAGAAGGAGGG + Intronic
1014243056 6:119039610-119039632 GGGGTTGAGGAGAGGGAGGAAGG + Intronic
1014358232 6:120438557-120438579 TGGGGTGAGGGGAAGGAGGAGGG + Intergenic
1015181988 6:130370401-130370423 TGGGATGAGGAGGAGGAGGCTGG + Intronic
1015386893 6:132634970-132634992 CGGGGTGAGCAGAAGCAGTGTGG + Intergenic
1016326810 6:142912420-142912442 TGTGATGAGGAGAAGGGGGAAGG - Intronic
1016330103 6:142945960-142945982 GAGGAGGAGGAGAAGGAGGACGG + Intergenic
1016466107 6:144327203-144327225 TGGGAGGAGGAGAAGGAGGAGGG + Intronic
1016640150 6:146338870-146338892 AGAGAAGAGAAGAAGGAGGAAGG - Intronic
1016749178 6:147613732-147613754 GAGGAAGAGCAGAAGGGGGAAGG + Intronic
1016985356 6:149890772-149890794 CTGGCTGAGGACAAGGAGGAGGG - Intronic
1017209401 6:151838219-151838241 CCGAAGGAGCAGAAGAAGGATGG + Intronic
1018437595 6:163776875-163776897 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1018776999 6:167026712-167026734 CTGAATGAGCAGCAGCAGGAAGG - Intronic
1018928795 6:168225922-168225944 GGGGAGAAGGAGAAGGAGGAGGG - Intergenic
1018996730 6:168715904-168715926 GAGGATGAGGAGGAGGAGGATGG + Intergenic
1019688842 7:2398387-2398409 GGGGATCAGCTGAAGGAGGAAGG - Intergenic
1019765867 7:2849727-2849749 TGTGATGAGCACCAGGAGGAAGG - Intergenic
1020577336 7:9949778-9949800 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1020847626 7:13306924-13306946 GGGGATGGGGAGAAGGGGGAGGG + Intergenic
1021482919 7:21137354-21137376 CAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1021818474 7:24473246-24473268 CTAGATGAGGAGATGGAGGAAGG + Intergenic
1021930978 7:25581134-25581156 TGGGAAGAGCAGATGGTGGAGGG - Intergenic
1023045174 7:36204423-36204445 GAGGAGGAGGAGAAGGAGGAGGG + Intronic
1023271706 7:38470114-38470136 GGGGATCAGGACAAGGAGGAAGG - Intronic
1023595204 7:41822417-41822439 AGGGAGGAGGAGAGGGAGGAAGG + Intergenic
1023638433 7:42236533-42236555 CGGGATGGGCGGAAGGAGGCGGG - Intronic
1023818177 7:43965915-43965937 CGGGTGGCGCAGCAGGAGGAGGG - Intergenic
1023878724 7:44306865-44306887 AGGTGTGAGCAGGAGGAGGAGGG + Intronic
1023878754 7:44306982-44307004 GGGTGTGAGCAGGAGGAGGAGGG + Intronic
1023878798 7:44307139-44307161 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878803 7:44307159-44307181 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878862 7:44307396-44307418 GGGGGTAAGCAGAAGGAGGAGGG + Intronic
1024054903 7:45653726-45653748 GGGTATGAGCAGAAGAAGGTGGG - Intronic
1024677254 7:51647779-51647801 TTGGATGAGGAGGAGGAGGAAGG - Intergenic
1024720953 7:52137073-52137095 GGAGAGGAGGAGAAGGAGGAGGG + Intergenic
1026191913 7:68136509-68136531 AGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1026191921 7:68136528-68136550 AGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1028078779 7:86548247-86548269 GAGGATGAGCTGAAGCAGGATGG - Intergenic
1029493429 7:100884523-100884545 AAGGATGAGAAGAAGGAAGACGG + Exonic
1029524551 7:101087077-101087099 GAGGAGGAGGAGAAGGAGGAGGG + Exonic
1029618479 7:101675116-101675138 CTGGATGTGCAGAAGGGGGTCGG - Intergenic
1029657170 7:101934934-101934956 GGTGAGGAGCAGGAGGAGGAAGG + Intronic
1029688267 7:102163719-102163741 CGGGCTGGGCAGGAAGAGGAGGG + Intronic
1029742804 7:102500747-102500769 CGGGTGGTGCAGCAGGAGGAGGG - Exonic
1029760794 7:102599908-102599930 CGGGTGGTGCAGCAGGAGGAGGG - Exonic
1030103482 7:105967095-105967117 TGGGGTGAGGGGAAGGAGGAGGG - Intronic
1030314011 7:108095777-108095799 CGGGTAGAGGAGAAGAAGGAGGG - Intronic
1030583098 7:111384308-111384330 AGGGAAAAGGAGAAGGAGGAGGG + Intronic
1030781856 7:113610699-113610721 GGGGAGGAGGAGGAGGAGGAGGG + Intergenic
1031327545 7:120420604-120420626 CGGGGTGAGGAGTAGGGGGAAGG + Intronic
1031564194 7:123274650-123274672 CTGAATGGGCACAAGGAGGAAGG - Intergenic
1031871257 7:127091727-127091749 AGGGATGACCAGTGGGAGGAGGG - Intronic
1032092904 7:128920579-128920601 CAGGCAGAGCAGAAGGAGGTCGG - Intergenic
1032553170 7:132804893-132804915 CGGGAGCAGCAGTGGGAGGAGGG + Intronic
1033443697 7:141402408-141402430 AGGAATGAGCAGCAGGGGGAGGG - Intronic
1033528755 7:142243112-142243134 AGGGAAGTGCAGAAGGAAGAAGG - Intergenic
1033604214 7:142913894-142913916 AGGGAGGGGCAGAAAGAGGAAGG - Intronic
1033754925 7:144390447-144390469 CTGGATAAGCAGAGGAAGGAAGG - Intergenic
1034280526 7:149850808-149850830 CAGGTGGATCAGAAGGAGGAAGG + Intronic
1034422236 7:150996065-150996087 TGGGATGGGGAGAAGGAGGAGGG - Intronic
1034422264 7:150996131-150996153 TGGGATGGGGAGAAGGAGGAGGG - Intronic
1034422289 7:150996196-150996218 TGGGACGGGGAGAAGGAGGAAGG - Intronic
1034597754 7:152214815-152214837 TGGGATGGGCAGAAGTAGGTCGG + Intronic
1035419704 7:158717345-158717367 CAGGAGGAGGAGAAGGAAGAAGG - Intergenic
1036767263 8:11556884-11556906 CGGGCTTAGCAGGAGGAGGAGGG + Intronic
1037635104 8:20694554-20694576 AGGGGTGAGCAGGAGGAGAAAGG - Intergenic
1037683305 8:21116824-21116846 CGGGATGTGAAGGAGAAGGAGGG - Intergenic
1037861460 8:22408454-22408476 GAGAATGAGCAGACGGAGGAGGG + Exonic
1038283977 8:26190471-26190493 CGGGTAGAGCAGCGGGAGGAGGG - Intergenic
1038311601 8:26449646-26449668 AGGGGTGAGCAGGAGGAGGGAGG + Intronic
1038425895 8:27463498-27463520 AGTGATGAGCAGCAGGAAGACGG + Exonic
1038596431 8:28890497-28890519 CAGGAAGAGGAGAAGGGGGAGGG - Exonic
1039317309 8:36387812-36387834 GGAGAAGAGCAGGAGGAGGAAGG - Intergenic
1039466620 8:37789241-37789263 GGGGAGGAACAGGAGGAGGAAGG + Intronic
1040042616 8:42931739-42931761 CGGGATGGGAAGAGGGAAGAGGG - Intronic
1040079772 8:43274918-43274940 GAGGAGGAGCAGGAGGAGGAGGG - Intergenic
1041191643 8:55361317-55361339 TGGGATGGGGAGAAGGAGGGAGG + Intronic
1041291170 8:56310133-56310155 AGGGAGGAGGAGGAGGAGGAAGG + Intronic
1041291181 8:56310165-56310187 AGGGAGGAGGAGGAGGAGGAAGG + Intronic
1042312076 8:67388798-67388820 TGGCAGGAGCAGGAGGAGGAGGG - Intergenic
1042478731 8:69280045-69280067 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1042889339 8:73589985-73590007 AGGGAGGAGGAGAAGGAAGAGGG + Intronic
1043499505 8:80838670-80838692 CTGGAGGAGGAGGAGGAGGAGGG + Intronic
1044966347 8:97577437-97577459 AGGACAGAGCAGAAGGAGGATGG + Intergenic
1045839269 8:106560855-106560877 GAGGATGAGCAAAAGCAGGATGG + Intronic
1045906169 8:107347634-107347656 TGGGATGAGGAGTGGGAGGAAGG + Intronic
1046351530 8:113020809-113020831 GGGGAACAGTAGAAGGAGGATGG + Intronic
1046451841 8:114402904-114402926 GGGGAAGAGGAGGAGGAGGAGGG - Intergenic
1046483080 8:114849113-114849135 TGGGATGAGGAGAGGGGGGAGGG + Intergenic
1046612909 8:116445311-116445333 GGGGAGGGGCAGAAGGTGGAGGG + Intergenic
1046632531 8:116635587-116635609 AGGGAAGAGGAGGAGGAGGAGGG - Intergenic
1047998521 8:130358405-130358427 CGGCATGAGCAGAGGGAGGCGGG - Intronic
1048861410 8:138726938-138726960 TGGGGTGACCAGAGGGAGGAAGG + Intronic
1049295170 8:141829250-141829272 GTGAATGAGCAGGAGGAGGAGGG + Intergenic
1049296547 8:141843504-141843526 CTGAATGAGCAGCAGGAGCAGGG + Intergenic
1049358380 8:142199910-142199932 CGGGATGGGCAGGAGGGAGATGG - Intergenic
1049497412 8:142942786-142942808 GGGCATGAGAGGAAGGAGGAAGG + Intergenic
1049558185 8:143294087-143294109 CAGGAGGGGCAGCAGGAGGAGGG - Intronic
1049653504 8:143787748-143787770 CAGGATGAGGGGAAGGAGGTGGG - Intergenic
1049963756 9:760345-760367 GAGGATGAGGGGAAGGAGGAGGG + Intergenic
1050088678 9:1993411-1993433 CGGGATAAAGGGAAGGAGGAAGG - Intergenic
1050452509 9:5798153-5798175 CTGGATGAGAAGAAATAGGATGG - Intronic
1050595352 9:7199456-7199478 CTGGATGGGCAGGAAGAGGAGGG + Intergenic
1052502808 9:29314111-29314133 CGGGAGGAAGAGAAGGAGGGAGG + Intergenic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1054991475 9:71331964-71331986 GAGGAGGAGGAGAAGGAGGAGGG + Intronic
1055191749 9:73532914-73532936 TGGGAAGAGCAGGATGAGGAAGG - Intergenic
1055398607 9:75899530-75899552 CGGGGTGAGGAGAGGGAGGAGGG - Intronic
1055723123 9:79197909-79197931 CAGGATGAGGAGGAGGAGGAAGG - Intergenic
1055807585 9:80114169-80114191 AGGGATCAGCTGAAGGTGGAAGG + Intergenic
1056200758 9:84274080-84274102 CTGCATGACCAGAAGGTGGAAGG + Intergenic
1056540463 9:87566724-87566746 CGGAATGAGAAGAACAAGGATGG + Intronic
1056897562 9:90565255-90565277 AGGGAAGGGGAGAAGGAGGAGGG - Intergenic
1058585897 9:106505805-106505827 CTGGCTTTGCAGAAGGAGGAAGG - Intergenic
1058593636 9:106591570-106591592 GGGGAGGAGCAGCAGGAGGTGGG + Intergenic
1059418539 9:114176762-114176784 AGCCCTGAGCAGAAGGAGGAGGG - Intronic
1059431205 9:114251406-114251428 AGGGAGGAGGAGGAGGAGGAAGG - Intronic
1059470904 9:114504505-114504527 CGGGATGACCAGACGAAGCATGG + Exonic
1059655533 9:116354226-116354248 AAGGAAGAGCAGAAGGAGCAAGG + Intronic
1059931088 9:119261872-119261894 GAGGAAGAGAAGAAGGAGGAGGG - Intronic
1060283524 9:122228979-122229001 GGGGAGGAGGAGAAGAAGGAGGG - Intronic
1060283538 9:122229027-122229049 GGGGAGGAGGACAAGGAGGAGGG - Intronic
1060968404 9:127724322-127724344 CGGGACGAGCAGCAGGAGAAAGG + Exonic
1061255604 9:129453219-129453241 GGGGATGAGGAGATGGGGGATGG + Intergenic
1061282988 9:129608072-129608094 CGGTATCCGCACAAGGAGGAAGG + Intergenic
1061905111 9:133692694-133692716 CGGGAGGAGGTGAAGGAGGCCGG - Intronic
1062103550 9:134740584-134740606 CTGGATGGATAGAAGGAGGACGG - Intronic
1062190716 9:135246619-135246641 GAGGATGAGCAGAAGGAAGGAGG - Intergenic
1062281286 9:135752880-135752902 AGAGATGAGCAGAAGGATGGAGG + Intronic
1062477521 9:136736121-136736143 GGGGAGGAGAAGAAGGAAGAAGG - Intergenic
1062540548 9:137040008-137040030 TCGGATGAGGAGAATGAGGACGG - Exonic
1203779986 EBV:95945-95967 CGGGAGGGGCAGGAGCAGGAGGG + Intergenic
1185540446 X:899193-899215 CGGGAGGAGAAGAAGAAAGAGGG - Intergenic
1186239999 X:7555444-7555466 AGGGAGGAAGAGAAGGAGGAAGG + Intergenic
1187402807 X:18976790-18976812 AGGGATCAGGAGAGGGAGGAGGG - Intronic
1188193129 X:27196830-27196852 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1189137354 X:38562573-38562595 GGGGAGGAGGAGGAGGAGGAGGG + Intronic
1189256321 X:39642504-39642526 CAGGATGAGGAGGAGGAGTAGGG + Intergenic
1189534599 X:41923507-41923529 CGGGAGGAGGAGAAAGAGGAGGG - Intergenic
1189726187 X:43969904-43969926 CGGGAGGAGGTGGAGGAGGAAGG + Intronic
1190058119 X:47193935-47193957 GGGGAGGAGGAGAAGGAGGAGGG + Exonic
1191135488 X:57059245-57059267 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1191870178 X:65739063-65739085 CAGGATGAGCAGGATGAGAATGG + Exonic
1191954782 X:66632437-66632459 CAGGAGGAGGAGGAGGAGGAGGG + Intronic
1192172360 X:68864999-68865021 GGGGAAGAGCAGAGGGAGAAGGG + Intergenic
1192639091 X:72846163-72846185 GAGGAGGAGAAGAAGGAGGAGGG + Intronic
1192642620 X:72874642-72874664 GAGGAGGAGAAGAAGGAGGAGGG - Intronic
1193043882 X:77032069-77032091 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1193394396 X:80967449-80967471 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1196181102 X:112690491-112690513 GAGGAAGAGAAGAAGGAGGAGGG + Intergenic
1197184665 X:123573356-123573378 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1198276021 X:135097210-135097232 TGGGCAGAGCAGATGGAGGAGGG - Intergenic
1198310492 X:135423522-135423544 TGGGCAGAGCAGATGGAGGAGGG + Intergenic
1198645577 X:138802388-138802410 AAGGGTGAGCAGAAGCAGGATGG - Intronic
1199005570 X:142692657-142692679 GGGGAGGAGCAGAAGGTTGACGG + Intergenic
1199263974 X:145808734-145808756 CAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1199850454 X:151722111-151722133 GGGGATGAGGAGGAAGAGGAAGG - Intronic
1200058514 X:153473809-153473831 GGAGATGAGGAGAAGGAAGAGGG - Intronic
1200847427 Y:7845315-7845337 TGGGATGAGGGGAAGGGGGAGGG + Intergenic
1201498739 Y:14618362-14618384 GAGGGTGAGCAGAAGTAGGATGG - Intronic
1201590552 Y:15610496-15610518 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1201710941 Y:16990914-16990936 TGGGGTGAGGGGAAGGAGGAGGG + Intergenic