ID: 1063245378

View in Genome Browser
Species Human (GRCh38)
Location 10:4212481-4212503
Sequence TCTTCCTTGTGGGTTACTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063245378_1063245383 7 Left 1063245378 10:4212481-4212503 CCTCCAGTAACCCACAAGGAAGA No data
Right 1063245383 10:4212511-4212533 CATGTCTCAGCTGCATGTGGTGG No data
1063245378_1063245384 10 Left 1063245378 10:4212481-4212503 CCTCCAGTAACCCACAAGGAAGA No data
Right 1063245384 10:4212514-4212536 GTCTCAGCTGCATGTGGTGGAGG No data
1063245378_1063245382 4 Left 1063245378 10:4212481-4212503 CCTCCAGTAACCCACAAGGAAGA No data
Right 1063245382 10:4212508-4212530 TGTCATGTCTCAGCTGCATGTGG No data
1063245378_1063245385 11 Left 1063245378 10:4212481-4212503 CCTCCAGTAACCCACAAGGAAGA No data
Right 1063245385 10:4212515-4212537 TCTCAGCTGCATGTGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063245378 Original CRISPR TCTTCCTTGTGGGTTACTGG AGG (reversed) Intergenic
No off target data available for this crispr