ID: 1063245381

View in Genome Browser
Species Human (GRCh38)
Location 10:4212492-4212514
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063245381_1063245382 -7 Left 1063245381 10:4212492-4212514 CCACAAGGAAGACATTTGTCATG No data
Right 1063245382 10:4212508-4212530 TGTCATGTCTCAGCTGCATGTGG No data
1063245381_1063245384 -1 Left 1063245381 10:4212492-4212514 CCACAAGGAAGACATTTGTCATG No data
Right 1063245384 10:4212514-4212536 GTCTCAGCTGCATGTGGTGGAGG No data
1063245381_1063245388 29 Left 1063245381 10:4212492-4212514 CCACAAGGAAGACATTTGTCATG No data
Right 1063245388 10:4212544-4212566 TGCAAGTTAAAATTTGGGAGAGG No data
1063245381_1063245385 0 Left 1063245381 10:4212492-4212514 CCACAAGGAAGACATTTGTCATG No data
Right 1063245385 10:4212515-4212537 TCTCAGCTGCATGTGGTGGAGGG No data
1063245381_1063245387 24 Left 1063245381 10:4212492-4212514 CCACAAGGAAGACATTTGTCATG No data
Right 1063245387 10:4212539-4212561 TCATCTGCAAGTTAAAATTTGGG No data
1063245381_1063245386 23 Left 1063245381 10:4212492-4212514 CCACAAGGAAGACATTTGTCATG No data
Right 1063245386 10:4212538-4212560 TTCATCTGCAAGTTAAAATTTGG No data
1063245381_1063245383 -4 Left 1063245381 10:4212492-4212514 CCACAAGGAAGACATTTGTCATG No data
Right 1063245383 10:4212511-4212533 CATGTCTCAGCTGCATGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063245381 Original CRISPR CATGACAAATGTCTTCCTTG TGG (reversed) Intergenic
No off target data available for this crispr