ID: 1063245385

View in Genome Browser
Species Human (GRCh38)
Location 10:4212515-4212537
Sequence TCTCAGCTGCATGTGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063245380_1063245385 1 Left 1063245380 10:4212491-4212513 CCCACAAGGAAGACATTTGTCAT No data
Right 1063245385 10:4212515-4212537 TCTCAGCTGCATGTGGTGGAGGG No data
1063245378_1063245385 11 Left 1063245378 10:4212481-4212503 CCTCCAGTAACCCACAAGGAAGA No data
Right 1063245385 10:4212515-4212537 TCTCAGCTGCATGTGGTGGAGGG No data
1063245379_1063245385 8 Left 1063245379 10:4212484-4212506 CCAGTAACCCACAAGGAAGACAT No data
Right 1063245385 10:4212515-4212537 TCTCAGCTGCATGTGGTGGAGGG No data
1063245381_1063245385 0 Left 1063245381 10:4212492-4212514 CCACAAGGAAGACATTTGTCATG No data
Right 1063245385 10:4212515-4212537 TCTCAGCTGCATGTGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063245385 Original CRISPR TCTCAGCTGCATGTGGTGGA GGG Intergenic
No off target data available for this crispr