ID: 1063246398

View in Genome Browser
Species Human (GRCh38)
Location 10:4224176-4224198
Sequence AAAGCTACTCAGAACAACCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063246398_1063246400 -6 Left 1063246398 10:4224176-4224198 CCGTGGTTGTTCTGAGTAGCTTT No data
Right 1063246400 10:4224193-4224215 AGCTTTGGCAGAGAACTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063246398 Original CRISPR AAAGCTACTCAGAACAACCA CGG (reversed) Intergenic
No off target data available for this crispr