ID: 1063255024

View in Genome Browser
Species Human (GRCh38)
Location 10:4317929-4317951
Sequence TCCACAATTTTGCCCACACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063255022_1063255024 0 Left 1063255022 10:4317906-4317928 CCATATATGAGAGTGCCAGGAGC No data
Right 1063255024 10:4317929-4317951 TCCACAATTTTGCCCACACTTGG No data
1063255019_1063255024 8 Left 1063255019 10:4317898-4317920 CCTGTCACCCATATATGAGAGTG No data
Right 1063255024 10:4317929-4317951 TCCACAATTTTGCCCACACTTGG No data
1063255021_1063255024 1 Left 1063255021 10:4317905-4317927 CCCATATATGAGAGTGCCAGGAG No data
Right 1063255024 10:4317929-4317951 TCCACAATTTTGCCCACACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063255024 Original CRISPR TCCACAATTTTGCCCACACT TGG Intergenic
No off target data available for this crispr