ID: 1063258220

View in Genome Browser
Species Human (GRCh38)
Location 10:4352893-4352915
Sequence GTGTTCAGGAGGAAAAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063258217_1063258220 -9 Left 1063258217 10:4352879-4352901 CCAATCACTAAGTGGTGTTCAGG No data
Right 1063258220 10:4352893-4352915 GTGTTCAGGAGGAAAAGAGCTGG No data
1063258215_1063258220 21 Left 1063258215 10:4352849-4352871 CCTCTGGGGAGGGGTAAAATGTG No data
Right 1063258220 10:4352893-4352915 GTGTTCAGGAGGAAAAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063258220 Original CRISPR GTGTTCAGGAGGAAAAGAGC TGG Intergenic
No off target data available for this crispr