ID: 1063258415

View in Genome Browser
Species Human (GRCh38)
Location 10:4355009-4355031
Sequence ATCAGCTGCCTGGCATACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063258415_1063258417 1 Left 1063258415 10:4355009-4355031 CCACAGTATGCCAGGCAGCTGAT No data
Right 1063258417 10:4355033-4355055 GAATTCATATGCCTTAGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063258415 Original CRISPR ATCAGCTGCCTGGCATACTG TGG (reversed) Intergenic
No off target data available for this crispr