ID: 1063261224

View in Genome Browser
Species Human (GRCh38)
Location 10:4391743-4391765
Sequence AATGTTATGAAGACTGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063261218_1063261224 27 Left 1063261218 10:4391693-4391715 CCAGATCAATGCTCATTTCTGCA No data
Right 1063261224 10:4391743-4391765 AATGTTATGAAGACTGTGGTAGG No data
1063261216_1063261224 29 Left 1063261216 10:4391691-4391713 CCCCAGATCAATGCTCATTTCTG No data
Right 1063261224 10:4391743-4391765 AATGTTATGAAGACTGTGGTAGG No data
1063261217_1063261224 28 Left 1063261217 10:4391692-4391714 CCCAGATCAATGCTCATTTCTGC No data
Right 1063261224 10:4391743-4391765 AATGTTATGAAGACTGTGGTAGG No data
1063261215_1063261224 30 Left 1063261215 10:4391690-4391712 CCCCCAGATCAATGCTCATTTCT No data
Right 1063261224 10:4391743-4391765 AATGTTATGAAGACTGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063261224 Original CRISPR AATGTTATGAAGACTGTGGT AGG Intergenic
No off target data available for this crispr