ID: 1063261751

View in Genome Browser
Species Human (GRCh38)
Location 10:4397070-4397092
Sequence TCCTTGTGTTTGTATTAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063261748_1063261751 1 Left 1063261748 10:4397046-4397068 CCATCATTAAGTGATGCCTGACT No data
Right 1063261751 10:4397070-4397092 TCCTTGTGTTTGTATTAGCCGGG No data
1063261747_1063261751 2 Left 1063261747 10:4397045-4397067 CCCATCATTAAGTGATGCCTGAC No data
Right 1063261751 10:4397070-4397092 TCCTTGTGTTTGTATTAGCCGGG No data
1063261746_1063261751 30 Left 1063261746 10:4397017-4397039 CCTAATGACACATTTCTCAGAAT No data
Right 1063261751 10:4397070-4397092 TCCTTGTGTTTGTATTAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063261751 Original CRISPR TCCTTGTGTTTGTATTAGCC GGG Intergenic