ID: 1063267961

View in Genome Browser
Species Human (GRCh38)
Location 10:4475180-4475202
Sequence AGAATGGGAGTCTCAGCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063267961_1063267970 23 Left 1063267961 10:4475180-4475202 CCACAGGCTGAGACTCCCATTCT No data
Right 1063267970 10:4475226-4475248 CACACAGCTGCCCTGGCTCTTGG No data
1063267961_1063267971 24 Left 1063267961 10:4475180-4475202 CCACAGGCTGAGACTCCCATTCT No data
Right 1063267971 10:4475227-4475249 ACACAGCTGCCCTGGCTCTTGGG No data
1063267961_1063267968 16 Left 1063267961 10:4475180-4475202 CCACAGGCTGAGACTCCCATTCT No data
Right 1063267968 10:4475219-4475241 ATATGTCCACACAGCTGCCCTGG No data
1063267961_1063267962 -9 Left 1063267961 10:4475180-4475202 CCACAGGCTGAGACTCCCATTCT No data
Right 1063267962 10:4475194-4475216 TCCCATTCTCCTGAATGCCCTGG No data
1063267961_1063267972 25 Left 1063267961 10:4475180-4475202 CCACAGGCTGAGACTCCCATTCT No data
Right 1063267972 10:4475228-4475250 CACAGCTGCCCTGGCTCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063267961 Original CRISPR AGAATGGGAGTCTCAGCCTG TGG (reversed) Intergenic
No off target data available for this crispr