ID: 1063267962

View in Genome Browser
Species Human (GRCh38)
Location 10:4475194-4475216
Sequence TCCCATTCTCCTGAATGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063267961_1063267962 -9 Left 1063267961 10:4475180-4475202 CCACAGGCTGAGACTCCCATTCT No data
Right 1063267962 10:4475194-4475216 TCCCATTCTCCTGAATGCCCTGG No data
1063267958_1063267962 18 Left 1063267958 10:4475153-4475175 CCAAGGAGGCCGATGGACAAGGA No data
Right 1063267962 10:4475194-4475216 TCCCATTCTCCTGAATGCCCTGG No data
1063267959_1063267962 9 Left 1063267959 10:4475162-4475184 CCGATGGACAAGGAGAGACCACA No data
Right 1063267962 10:4475194-4475216 TCCCATTCTCCTGAATGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063267962 Original CRISPR TCCCATTCTCCTGAATGCCC TGG Intergenic
No off target data available for this crispr