ID: 1063267965

View in Genome Browser
Species Human (GRCh38)
Location 10:4475203-4475225
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063267965_1063267972 2 Left 1063267965 10:4475203-4475225 CCTGAATGCCCTGGAAATATGTC No data
Right 1063267972 10:4475228-4475250 CACAGCTGCCCTGGCTCTTGGGG No data
1063267965_1063267968 -7 Left 1063267965 10:4475203-4475225 CCTGAATGCCCTGGAAATATGTC No data
Right 1063267968 10:4475219-4475241 ATATGTCCACACAGCTGCCCTGG No data
1063267965_1063267975 11 Left 1063267965 10:4475203-4475225 CCTGAATGCCCTGGAAATATGTC No data
Right 1063267975 10:4475237-4475259 CCTGGCTCTTGGGGCATCCCAGG No data
1063267965_1063267971 1 Left 1063267965 10:4475203-4475225 CCTGAATGCCCTGGAAATATGTC No data
Right 1063267971 10:4475227-4475249 ACACAGCTGCCCTGGCTCTTGGG No data
1063267965_1063267970 0 Left 1063267965 10:4475203-4475225 CCTGAATGCCCTGGAAATATGTC No data
Right 1063267970 10:4475226-4475248 CACACAGCTGCCCTGGCTCTTGG No data
1063267965_1063267976 14 Left 1063267965 10:4475203-4475225 CCTGAATGCCCTGGAAATATGTC No data
Right 1063267976 10:4475240-4475262 GGCTCTTGGGGCATCCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063267965 Original CRISPR GACATATTTCCAGGGCATTC AGG (reversed) Intergenic
No off target data available for this crispr