ID: 1063267966

View in Genome Browser
Species Human (GRCh38)
Location 10:4475211-4475233
Sequence GCTGTGTGGACATATTTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063267966_1063267972 -6 Left 1063267966 10:4475211-4475233 CCCTGGAAATATGTCCACACAGC No data
Right 1063267972 10:4475228-4475250 CACAGCTGCCCTGGCTCTTGGGG No data
1063267966_1063267975 3 Left 1063267966 10:4475211-4475233 CCCTGGAAATATGTCCACACAGC No data
Right 1063267975 10:4475237-4475259 CCTGGCTCTTGGGGCATCCCAGG No data
1063267966_1063267976 6 Left 1063267966 10:4475211-4475233 CCCTGGAAATATGTCCACACAGC No data
Right 1063267976 10:4475240-4475262 GGCTCTTGGGGCATCCCAGGAGG No data
1063267966_1063267970 -8 Left 1063267966 10:4475211-4475233 CCCTGGAAATATGTCCACACAGC No data
Right 1063267970 10:4475226-4475248 CACACAGCTGCCCTGGCTCTTGG No data
1063267966_1063267971 -7 Left 1063267966 10:4475211-4475233 CCCTGGAAATATGTCCACACAGC No data
Right 1063267971 10:4475227-4475249 ACACAGCTGCCCTGGCTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063267966 Original CRISPR GCTGTGTGGACATATTTCCA GGG (reversed) Intergenic
No off target data available for this crispr