ID: 1063267968

View in Genome Browser
Species Human (GRCh38)
Location 10:4475219-4475241
Sequence ATATGTCCACACAGCTGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063267963_1063267968 1 Left 1063267963 10:4475195-4475217 CCCATTCTCCTGAATGCCCTGGA No data
Right 1063267968 10:4475219-4475241 ATATGTCCACACAGCTGCCCTGG No data
1063267964_1063267968 0 Left 1063267964 10:4475196-4475218 CCATTCTCCTGAATGCCCTGGAA No data
Right 1063267968 10:4475219-4475241 ATATGTCCACACAGCTGCCCTGG No data
1063267965_1063267968 -7 Left 1063267965 10:4475203-4475225 CCTGAATGCCCTGGAAATATGTC No data
Right 1063267968 10:4475219-4475241 ATATGTCCACACAGCTGCCCTGG No data
1063267961_1063267968 16 Left 1063267961 10:4475180-4475202 CCACAGGCTGAGACTCCCATTCT No data
Right 1063267968 10:4475219-4475241 ATATGTCCACACAGCTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063267968 Original CRISPR ATATGTCCACACAGCTGCCC TGG Intergenic
No off target data available for this crispr