ID: 1063267976

View in Genome Browser
Species Human (GRCh38)
Location 10:4475240-4475262
Sequence GGCTCTTGGGGCATCCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063267967_1063267976 5 Left 1063267967 10:4475212-4475234 CCTGGAAATATGTCCACACAGCT No data
Right 1063267976 10:4475240-4475262 GGCTCTTGGGGCATCCCAGGAGG No data
1063267965_1063267976 14 Left 1063267965 10:4475203-4475225 CCTGAATGCCCTGGAAATATGTC No data
Right 1063267976 10:4475240-4475262 GGCTCTTGGGGCATCCCAGGAGG No data
1063267969_1063267976 -8 Left 1063267969 10:4475225-4475247 CCACACAGCTGCCCTGGCTCTTG No data
Right 1063267976 10:4475240-4475262 GGCTCTTGGGGCATCCCAGGAGG No data
1063267964_1063267976 21 Left 1063267964 10:4475196-4475218 CCATTCTCCTGAATGCCCTGGAA No data
Right 1063267976 10:4475240-4475262 GGCTCTTGGGGCATCCCAGGAGG No data
1063267963_1063267976 22 Left 1063267963 10:4475195-4475217 CCCATTCTCCTGAATGCCCTGGA No data
Right 1063267976 10:4475240-4475262 GGCTCTTGGGGCATCCCAGGAGG No data
1063267966_1063267976 6 Left 1063267966 10:4475211-4475233 CCCTGGAAATATGTCCACACAGC No data
Right 1063267976 10:4475240-4475262 GGCTCTTGGGGCATCCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063267976 Original CRISPR GGCTCTTGGGGCATCCCAGG AGG Intergenic
No off target data available for this crispr