ID: 1063274673

View in Genome Browser
Species Human (GRCh38)
Location 10:4552542-4552564
Sequence GCTTCAGGAGTGTCCCCGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063274673_1063274677 2 Left 1063274673 10:4552542-4552564 CCTGGCGGGGACACTCCTGAAGC No data
Right 1063274677 10:4552567-4552589 TTGGGAGTGATCCTCCCTCCTGG No data
1063274673_1063274685 26 Left 1063274673 10:4552542-4552564 CCTGGCGGGGACACTCCTGAAGC No data
Right 1063274685 10:4552591-4552613 CCAATGCCAGAGAGTGTGAGGGG No data
1063274673_1063274682 24 Left 1063274673 10:4552542-4552564 CCTGGCGGGGACACTCCTGAAGC No data
Right 1063274682 10:4552589-4552611 GTCCAATGCCAGAGAGTGTGAGG No data
1063274673_1063274686 30 Left 1063274673 10:4552542-4552564 CCTGGCGGGGACACTCCTGAAGC No data
Right 1063274686 10:4552595-4552617 TGCCAGAGAGTGTGAGGGGAAGG No data
1063274673_1063274683 25 Left 1063274673 10:4552542-4552564 CCTGGCGGGGACACTCCTGAAGC No data
Right 1063274683 10:4552590-4552612 TCCAATGCCAGAGAGTGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063274673 Original CRISPR GCTTCAGGAGTGTCCCCGCC AGG (reversed) Intergenic
No off target data available for this crispr