ID: 1063275115

View in Genome Browser
Species Human (GRCh38)
Location 10:4557566-4557588
Sequence GGTCACTCCACTCCAAAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063275105_1063275115 29 Left 1063275105 10:4557514-4557536 CCAGTTTAGGAGTCTACTGTGCT No data
Right 1063275115 10:4557566-4557588 GGTCACTCCACTCCAAAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063275115 Original CRISPR GGTCACTCCACTCCAAAGGG TGG Intergenic
No off target data available for this crispr