ID: 1063275936

View in Genome Browser
Species Human (GRCh38)
Location 10:4568036-4568058
Sequence CTATAACAGCAGCAGTAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063275930_1063275936 29 Left 1063275930 10:4567984-4568006 CCATACTTGCTAAAAAGGAATCT No data
Right 1063275936 10:4568036-4568058 CTATAACAGCAGCAGTAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063275936 Original CRISPR CTATAACAGCAGCAGTAGAG GGG Intergenic
No off target data available for this crispr