ID: 1063276402

View in Genome Browser
Species Human (GRCh38)
Location 10:4573264-4573286
Sequence CAGCCAAAAAACTCTCTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063276402_1063276406 2 Left 1063276402 10:4573264-4573286 CCACCTAGAGAGTTTTTTGGCTG No data
Right 1063276406 10:4573289-4573311 AGAGGCATAATAAAACTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063276402 Original CRISPR CAGCCAAAAAACTCTCTAGG TGG (reversed) Intergenic
No off target data available for this crispr