ID: 1063278401

View in Genome Browser
Species Human (GRCh38)
Location 10:4597188-4597210
Sequence ATGCAGGAGCAGGGTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063278401_1063278409 25 Left 1063278401 10:4597188-4597210 CCCTCCTCACCCTGCTCCTGCAT No data
Right 1063278409 10:4597236-4597258 ACTTCCTGCTCCCTCTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063278401 Original CRISPR ATGCAGGAGCAGGGTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr