ID: 1063278409

View in Genome Browser
Species Human (GRCh38)
Location 10:4597236-4597258
Sequence ACTTCCTGCTCCCTCTGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063278402_1063278409 24 Left 1063278402 10:4597189-4597211 CCTCCTCACCCTGCTCCTGCATC No data
Right 1063278409 10:4597236-4597258 ACTTCCTGCTCCCTCTGCCCTGG No data
1063278403_1063278409 21 Left 1063278403 10:4597192-4597214 CCTCACCCTGCTCCTGCATCTGC No data
Right 1063278409 10:4597236-4597258 ACTTCCTGCTCCCTCTGCCCTGG No data
1063278407_1063278409 -3 Left 1063278407 10:4597216-4597238 CCTCACCATGTTGCTGTTACACT No data
Right 1063278409 10:4597236-4597258 ACTTCCTGCTCCCTCTGCCCTGG No data
1063278408_1063278409 -8 Left 1063278408 10:4597221-4597243 CCATGTTGCTGTTACACTTCCTG No data
Right 1063278409 10:4597236-4597258 ACTTCCTGCTCCCTCTGCCCTGG No data
1063278401_1063278409 25 Left 1063278401 10:4597188-4597210 CCCTCCTCACCCTGCTCCTGCAT No data
Right 1063278409 10:4597236-4597258 ACTTCCTGCTCCCTCTGCCCTGG No data
1063278404_1063278409 16 Left 1063278404 10:4597197-4597219 CCCTGCTCCTGCATCTGCTCCTC No data
Right 1063278409 10:4597236-4597258 ACTTCCTGCTCCCTCTGCCCTGG No data
1063278406_1063278409 9 Left 1063278406 10:4597204-4597226 CCTGCATCTGCTCCTCACCATGT No data
Right 1063278409 10:4597236-4597258 ACTTCCTGCTCCCTCTGCCCTGG No data
1063278405_1063278409 15 Left 1063278405 10:4597198-4597220 CCTGCTCCTGCATCTGCTCCTCA No data
Right 1063278409 10:4597236-4597258 ACTTCCTGCTCCCTCTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063278409 Original CRISPR ACTTCCTGCTCCCTCTGCCC TGG Intergenic
No off target data available for this crispr