ID: 1063279983

View in Genome Browser
Species Human (GRCh38)
Location 10:4617690-4617712
Sequence CTAGATTCCCAGGAATAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063279980_1063279983 -1 Left 1063279980 10:4617668-4617690 CCTTGCATATGCATGTAACCATC No data
Right 1063279983 10:4617690-4617712 CTAGATTCCCAGGAATAAGCTGG No data
1063279979_1063279983 8 Left 1063279979 10:4617659-4617681 CCTGTGCAGCCTTGCATATGCAT No data
Right 1063279983 10:4617690-4617712 CTAGATTCCCAGGAATAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063279983 Original CRISPR CTAGATTCCCAGGAATAAGC TGG Intergenic
No off target data available for this crispr