ID: 1063280359 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:4622413-4622435 |
| Sequence | AAATGCTTTTAGAAGTAGGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1063280359_1063280367 | 13 | Left | 1063280359 | 10:4622413-4622435 | CCTTCCTACTTCTAAAAGCATTT | No data | ||
| Right | 1063280367 | 10:4622449-4622471 | AAACTCTAATAGATCATATCGGG | No data | ||||
| 1063280359_1063280366 | 12 | Left | 1063280359 | 10:4622413-4622435 | CCTTCCTACTTCTAAAAGCATTT | No data | ||
| Right | 1063280366 | 10:4622448-4622470 | CAAACTCTAATAGATCATATCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1063280359 | Original CRISPR | AAATGCTTTTAGAAGTAGGA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||