ID: 1063280366

View in Genome Browser
Species Human (GRCh38)
Location 10:4622448-4622470
Sequence CAAACTCTAATAGATCATAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063280359_1063280366 12 Left 1063280359 10:4622413-4622435 CCTTCCTACTTCTAAAAGCATTT No data
Right 1063280366 10:4622448-4622470 CAAACTCTAATAGATCATATCGG No data
1063280358_1063280366 13 Left 1063280358 10:4622412-4622434 CCCTTCCTACTTCTAAAAGCATT No data
Right 1063280366 10:4622448-4622470 CAAACTCTAATAGATCATATCGG No data
1063280361_1063280366 8 Left 1063280361 10:4622417-4622439 CCTACTTCTAAAAGCATTTAGGG No data
Right 1063280366 10:4622448-4622470 CAAACTCTAATAGATCATATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063280366 Original CRISPR CAAACTCTAATAGATCATAT CGG Intergenic
No off target data available for this crispr