ID: 1063280367

View in Genome Browser
Species Human (GRCh38)
Location 10:4622449-4622471
Sequence AAACTCTAATAGATCATATC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063280358_1063280367 14 Left 1063280358 10:4622412-4622434 CCCTTCCTACTTCTAAAAGCATT No data
Right 1063280367 10:4622449-4622471 AAACTCTAATAGATCATATCGGG No data
1063280361_1063280367 9 Left 1063280361 10:4622417-4622439 CCTACTTCTAAAAGCATTTAGGG No data
Right 1063280367 10:4622449-4622471 AAACTCTAATAGATCATATCGGG No data
1063280359_1063280367 13 Left 1063280359 10:4622413-4622435 CCTTCCTACTTCTAAAAGCATTT No data
Right 1063280367 10:4622449-4622471 AAACTCTAATAGATCATATCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063280367 Original CRISPR AAACTCTAATAGATCATATC GGG Intergenic
No off target data available for this crispr