ID: 1063283845

View in Genome Browser
Species Human (GRCh38)
Location 10:4661692-4661714
Sequence CTTGCAGAAGAGCCGTCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 82}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063283841_1063283845 7 Left 1063283841 10:4661662-4661684 CCTCCACTCCGTTTGTGTTTCCT No data
Right 1063283845 10:4661692-4661714 CTTGCAGAAGAGCCGTCCTCTGG 0: 1
1: 0
2: 1
3: 10
4: 82
1063283842_1063283845 4 Left 1063283842 10:4661665-4661687 CCACTCCGTTTGTGTTTCCTTTT No data
Right 1063283845 10:4661692-4661714 CTTGCAGAAGAGCCGTCCTCTGG 0: 1
1: 0
2: 1
3: 10
4: 82
1063283843_1063283845 -1 Left 1063283843 10:4661670-4661692 CCGTTTGTGTTTCCTTTTCTTTC No data
Right 1063283845 10:4661692-4661714 CTTGCAGAAGAGCCGTCCTCTGG 0: 1
1: 0
2: 1
3: 10
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063283845 Original CRISPR CTTGCAGAAGAGCCGTCCTC TGG Intergenic
902367959 1:15989743-15989765 TTTGAAGAAGAGGCTTCCTCAGG - Intergenic
906720533 1:48001131-48001153 CTTGCAGGAGGGCAGCCCTCAGG - Intergenic
907679483 1:56550325-56550347 CTGGCAAAAGAGCCTCCCTCTGG - Intronic
908403818 1:63794584-63794606 CTAGCTGGAGAGCCGCCCTCTGG - Intronic
912035728 1:105310240-105310262 CTTGCAGAAGGGCTGTCATCTGG - Intergenic
916291201 1:163168202-163168224 CTTGGAAAATAGCCATCCTCTGG + Intronic
1063283845 10:4661692-4661714 CTTGCAGAAGAGCCGTCCTCTGG + Intergenic
1064436618 10:15316450-15316472 CTTGTAGGAGAGCATTCCTCGGG + Intronic
1067700890 10:48571136-48571158 CTTGGAGAAGAGCTGACCACTGG - Intronic
1075277055 10:121103672-121103694 CTGGGAGAAGAGGAGTCCTCAGG - Intergenic
1077302219 11:1852641-1852663 CCTGTAGGAGAGCCGGCCTCTGG + Intergenic
1082029753 11:47595446-47595468 CCTGCAGAACCCCCGTCCTCTGG + Intergenic
1089705567 11:120275296-120275318 CTCTCAGAAGAGCCCTCCACTGG - Intronic
1099116390 12:78630473-78630495 CTTGCAGAAGAGTAGTACTATGG - Intergenic
1100318543 12:93467695-93467717 CCTGCAGAAGAGCCGGCATGTGG + Intronic
1104612758 12:130242879-130242901 ATTGCAGAAGAGGCCTCCTGGGG - Intergenic
1107568386 13:41630220-41630242 CTTGCAGAAGTCCTGTCTTCTGG + Intronic
1107966964 13:45605643-45605665 TTTGGAGGAGAGCCCTCCTCAGG + Intronic
1112326035 13:98443447-98443469 CTCGCAGATGAGCCATCCCCAGG + Intronic
1115193562 14:30772464-30772486 TGTGCAGAAGAGCAGTCCTCGGG - Intergenic
1121894266 14:97630990-97631012 CTTTCAGAGGAGCCTTCCTCCGG - Intergenic
1123895191 15:24821719-24821741 CTTGCAGAGGAGCTGTCAGCAGG + Intergenic
1127727502 15:61764371-61764393 CTGGCAACAGAGCCCTCCTCTGG - Intergenic
1128665863 15:69538051-69538073 CTTCCAGAAGAGAAGGCCTCAGG + Intergenic
1129535463 15:76310915-76310937 CTTCCAGAAATGCCGGCCTCCGG + Intronic
1129862734 15:78875237-78875259 CTTCCAGAACAGCCATCCTTAGG - Intronic
1139642030 16:68298670-68298692 CCTGCTGAAGAGCCGGACTCAGG - Exonic
1140996876 16:80268648-80268670 CTTTGAGAAGAGCAGTCATCGGG + Intergenic
1141093743 16:81148247-81148269 CTTTCAGAACACCCGTCCCCGGG - Intergenic
1142420013 16:89964322-89964344 GTTGGAGAAGAGCGGCCCTCGGG - Intronic
1143072342 17:4307087-4307109 CCTGCAGAAAAGCCTTCCACTGG + Exonic
1144393623 17:14820725-14820747 CCTGCTGAGGAGCCGTCCTTTGG + Intergenic
1144448183 17:15351574-15351596 CTTGAAGATGAACTGTCCTCAGG + Intergenic
1147654513 17:42081231-42081253 CTTGCAGAAGACCAGCACTCAGG + Intergenic
1148063479 17:44852283-44852305 CCTGGAGAAGAGTCCTCCTCTGG - Intronic
1149981981 17:61318070-61318092 CTAGCAGGAGAGGCGGCCTCTGG - Intronic
1150995050 17:70307521-70307543 CTGGCAGCAGAGCCGTGCTTTGG + Intergenic
1151951161 17:77354893-77354915 CTTGTAAAAGAGCAGTGCTCGGG - Intronic
1152660480 17:81539731-81539753 CTTGCAGCAGAGCCCTCCTCAGG + Intergenic
1152746610 17:82043290-82043312 CCTGCAGGAGAGCCACCCTCAGG + Intergenic
1152888826 17:82868229-82868251 CCCACAGAAGAGCTGTCCTCCGG - Intronic
1153601624 18:6786436-6786458 AGTGGAGAAGAGCAGTCCTCAGG + Intronic
1156732174 18:40207322-40207344 CTGGCAGAAAAGCTGTCCTCTGG - Intergenic
1167399410 19:49255103-49255125 ATTGCAGAAGAGCAGTCAACAGG + Intergenic
1167415752 19:49370906-49370928 CTTCCTGAAGAGATGTCCTCAGG + Intronic
927510167 2:23639387-23639409 CCTGCAGAAGCCCCCTCCTCAGG + Intronic
932142900 2:69295215-69295237 CTTGCAGTAGAGACGTCTCCTGG + Intergenic
932462892 2:71894643-71894665 CTTGCAGTGGAGCCATCCTGGGG - Intergenic
938105765 2:128528807-128528829 CTTGCAGAAGGCCTGTCCCCCGG - Intergenic
940240951 2:151562658-151562680 CTTCCAGAAGAGACGTCCACTGG + Exonic
940702004 2:157056927-157056949 CATGCAGTTGAGCTGTCCTCTGG + Intergenic
1169017586 20:2304418-2304440 CTTCCAAAAGAGCCGTCTTCAGG - Intronic
1172867081 20:38108510-38108532 GTTGCATAAGAGCCTGCCTCTGG - Intronic
1172891901 20:38271517-38271539 CTTGCAGAACAGGGGTCCCCTGG - Intronic
1174473819 20:50781702-50781724 CTTGAAGAATAGCAGTCTTCAGG + Intergenic
1176021216 20:62963336-62963358 CTTCCGGAAGAGCCGTCTCCAGG - Exonic
1180126977 21:45799605-45799627 CTTGCAGAAGATCTGTTCTGAGG - Intronic
1180157383 21:45984106-45984128 CTTCCAGGAGGGCCGGCCTCAGG + Intronic
1181887022 22:26029620-26029642 CTTGGAGAAGAACCTTGCTCAGG - Intronic
1182362673 22:29756209-29756231 CGTGCAATAAAGCCGTCCTCTGG - Intronic
1184119248 22:42439808-42439830 CTTGCAGAAGCCCCCTCCCCAGG + Intergenic
1185329713 22:50246736-50246758 CTGGAAGAAGAGCTGGCCTCAGG + Intronic
954631786 3:52051732-52051754 CTTCCAGAGGAGCCTCCCTCAGG - Intronic
961785524 3:129344571-129344593 CCTGCAGCAGGGCTGTCCTCCGG + Intergenic
967299251 3:187996379-187996401 TTTCTAGAAGAGCTGTCCTCTGG + Intergenic
968661258 4:1799740-1799762 CTTGCAGACGCTCCATCCTCGGG + Exonic
969581733 4:8069231-8069253 CTGGCAGACGAGCCGTCCAGTGG + Intronic
972186334 4:36532812-36532834 CTTGCAGACGACCTGTCCTGGGG - Intergenic
978118135 4:105047145-105047167 CCTGCAGAGGAGCTGGCCTCAGG - Intergenic
985534186 5:454119-454141 CTTGCTGGAGAGCCGACCTCAGG + Intronic
992518741 5:77524969-77524991 TTTGCAGAAAATCAGTCCTCTGG + Intronic
998987938 5:147782744-147782766 CTTGCAGCAGACACCTCCTCTGG + Exonic
999148645 5:149412376-149412398 CTTGCAGAAGAGCCATGGTGGGG - Intergenic
1001919883 5:175591379-175591401 CTTTCAGAAGAGCTGACCTCAGG - Intergenic
1003640371 6:7870567-7870589 CTTGCTGAAGAACCTTCCTTAGG + Intronic
1018649138 6:165976825-165976847 CCTGCAGCAGGGCCCTCCTCGGG + Intronic
1019332018 7:464911-464933 TTTCCAGCAGATCCGTCCTCAGG + Intergenic
1024938597 7:54739123-54739145 CCAGCAGAAGAGCCTGCCTCTGG - Intergenic
1032575050 7:133044753-133044775 ATGGCAGAAGAGCAGTCCACTGG + Intronic
1036958231 8:13214522-13214544 CTTACTGAAGAGCTGTCCCCCGG + Intronic
1039212799 8:35235747-35235769 CGTGAAGAAGAGCCGCCCTCCGG + Exonic
1048835111 8:138512045-138512067 CTAGCAGTAAAGCCTTCCTCAGG - Intergenic
1051108577 9:13608699-13608721 CATTCAGAAGAGCCTGCCTCAGG - Intergenic
1053416717 9:37951568-37951590 TTTGAAGCTGAGCCGTCCTCAGG + Intronic
1056393991 9:86164848-86164870 CTTGAAGAAGAGCTGTCAGCTGG + Intergenic
1058816977 9:108693476-108693498 CTTGGAGAACAGCTGTCCTCTGG + Intergenic
1061159741 9:128886544-128886566 CTTGAATCAGAGCCGTCATCAGG + Intronic
1187596964 X:20783833-20783855 CTTGCAGAAGAACCATCCCTGGG + Intergenic
1190741275 X:53290460-53290482 CTTGCAGGAGCCCCGTGCTCGGG + Intronic
1195288266 X:103406284-103406306 TTTGCAGGACAGCAGTCCTCAGG + Intergenic
1196164238 X:112521030-112521052 CTGGCAGAAGTGCCGTACTTTGG - Intergenic
1197412327 X:126134036-126134058 ATTGCAGAAGACCTGTCCTTGGG + Intergenic
1198231236 X:134691637-134691659 TTTCCAGAAGGGCCGTCCTAAGG - Intronic
1200088481 X:153623462-153623484 CTTGCAGAGGGGCTGACCTCAGG - Intergenic