ID: 1063287768

View in Genome Browser
Species Human (GRCh38)
Location 10:4709071-4709093
Sequence CTTTCTCTGCAGGACATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063287765_1063287768 0 Left 1063287765 10:4709048-4709070 CCTTCATTTCTGAGTATAATGCT No data
Right 1063287768 10:4709071-4709093 CTTTCTCTGCAGGACATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063287768 Original CRISPR CTTTCTCTGCAGGACATGGC AGG Intergenic
No off target data available for this crispr