ID: 1063289727

View in Genome Browser
Species Human (GRCh38)
Location 10:4733222-4733244
Sequence AGCCAACCCAGAATCTATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063289727_1063289729 0 Left 1063289727 10:4733222-4733244 CCCACATAGATTCTGGGTTGGCT No data
Right 1063289729 10:4733245-4733267 ATGAGACTTGCTTTTGCCTGTGG No data
1063289727_1063289730 1 Left 1063289727 10:4733222-4733244 CCCACATAGATTCTGGGTTGGCT No data
Right 1063289730 10:4733246-4733268 TGAGACTTGCTTTTGCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063289727 Original CRISPR AGCCAACCCAGAATCTATGT GGG (reversed) Intergenic
No off target data available for this crispr