ID: 1063292401

View in Genome Browser
Species Human (GRCh38)
Location 10:4762787-4762809
Sequence GAATGAAGGAAGTTGATAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063292399_1063292401 16 Left 1063292399 10:4762748-4762770 CCATGGGAGGAAGAGAGAGAGAG No data
Right 1063292401 10:4762787-4762809 GAATGAAGGAAGTTGATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063292401 Original CRISPR GAATGAAGGAAGTTGATAGC AGG Intergenic
No off target data available for this crispr