ID: 1063293243

View in Genome Browser
Species Human (GRCh38)
Location 10:4773441-4773463
Sequence CTGCAGAAAATGGAAGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063293241_1063293243 10 Left 1063293241 10:4773408-4773430 CCAGGAGAATTAGGTTAAACTTT No data
Right 1063293243 10:4773441-4773463 CTGCAGAAAATGGAAGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063293243 Original CRISPR CTGCAGAAAATGGAAGCAGA AGG Intergenic
No off target data available for this crispr