ID: 1063297142

View in Genome Browser
Species Human (GRCh38)
Location 10:4818002-4818024
Sequence CCTCTCCTGGACCCAAGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 215}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063297142 Original CRISPR CCTCTCCTGGACCCAAGGAT GGG (reversed) Intronic
901924181 1:12555464-12555486 CCTCTCCAGGCCCCAAGGCTTGG - Intergenic
902879212 1:19359913-19359935 CCTCGCCTCGCCCCAAGAATGGG - Intronic
903233697 1:21936826-21936848 CCCCTCCTGGTCCCCAGGAATGG + Intronic
903361244 1:22778728-22778750 CCTCTCCTGGCCCAAAGCAGTGG - Intronic
903757068 1:25669901-25669923 CCTTTCCTGGACTCAAGAAGGGG - Intronic
903778154 1:25806227-25806249 TCTCTCCTGGCCCCACTGATTGG - Intronic
904425825 1:30422401-30422423 CCTCTCCAGTACCCAAGGCCAGG + Intergenic
905364471 1:37441843-37441865 CCTCTCCACGCCCCAAGCATTGG + Intergenic
905657012 1:39691779-39691801 CCTTTCCTGGGCCCCAGCATGGG + Intergenic
906243375 1:44256387-44256409 CCTCTGCTGGACCCGAGGAATGG - Intronic
906667816 1:47633921-47633943 CCTATCCTATGCCCAAGGATGGG - Intergenic
910937018 1:92492644-92492666 CCCCTCCTGGATCAAAGGTTAGG + Intergenic
911188598 1:94926956-94926978 CCGCTCCTGGCCCCGAGGAGTGG + Exonic
917306269 1:173628344-173628366 GCTCTCCAGGAGCCAAGGCTTGG - Intronic
918077429 1:181181207-181181229 CCCCTCCTGGACACATGGAAAGG + Intergenic
918380515 1:183949956-183949978 ACTCTACTGCACCCAAGAATAGG + Intronic
919761751 1:201102439-201102461 CCTCTATTGGGCCCAAGGGTTGG - Intronic
921202214 1:212818253-212818275 CCTGTGCTAGACCCAAGGACTGG + Intergenic
922350627 1:224732243-224732265 CCTCACCTGCACCCAATTATGGG - Intronic
1063297142 10:4818002-4818024 CCTCTCCTGGACCCAAGGATGGG - Intronic
1063851057 10:10191056-10191078 CCTCACCTGGACCCAATTCTTGG + Intergenic
1064222765 10:13455721-13455743 CCTCTTCTGAACCCACGGAAAGG + Intronic
1064778883 10:18810853-18810875 CCTCTCATGGACACAAGGCGGGG + Intergenic
1068708613 10:60106018-60106040 CCTCTCATGGACCCAAAGTGAGG + Exonic
1069783103 10:70969245-70969267 CCTCCCCTGGACCCCAGGGCGGG + Intergenic
1069899774 10:71700787-71700809 CCTCCCCAGGACCCATGGACAGG + Intronic
1071526485 10:86362640-86362662 CCTCTGCTGCACCCAAGAATAGG + Intronic
1076352951 10:129831321-129831343 CCACTCCTGCACCATAGGATGGG + Intergenic
1077341495 11:2028321-2028343 CCTCTCCTGGAACCAGGGTGTGG - Intergenic
1077721839 11:4637692-4637714 CCTGTCCTGGGACAAAGGATAGG - Intergenic
1078423401 11:11230345-11230367 CCTCTGCTGGTCGCAAGGCTTGG + Intergenic
1083815826 11:65132016-65132038 CCTCTCCTGAGCCCCAGGTTGGG + Intronic
1084147345 11:67272134-67272156 CCTTCCCTGGAACCCAGGATGGG - Intronic
1084192879 11:67506797-67506819 CCCCTCCAGGAACCAAGGAGTGG - Exonic
1084646686 11:70463240-70463262 CGCCTCCTGGTCCCAGGGATTGG + Intergenic
1085054048 11:73393936-73393958 CCTCTCCTGGGCACTGGGATGGG - Intronic
1085644846 11:78216340-78216362 CCTCTCCAGGCCCCCAGGAGAGG + Exonic
1085727723 11:78968628-78968650 CCTCTCCTGGAGGCCAGGAACGG + Intronic
1087240307 11:95767724-95767746 CCTCTCATGGAGTTAAGGATTGG - Intergenic
1089058741 11:115608751-115608773 CCTCTCCCAAACCCATGGATAGG + Intergenic
1089587655 11:119520445-119520467 CCTCTGCTGGACTCAGGGGTGGG + Intergenic
1089757007 11:120694662-120694684 CACCTCCTGCACCCAAGGCTGGG - Intronic
1090422381 11:126584423-126584445 ACTCTCCTGGACTCTAGGATGGG + Intronic
1202824481 11_KI270721v1_random:83510-83532 CCTCTCCTGGAACCAGGGTGTGG - Intergenic
1091396490 12:156814-156836 CCTCTCCTGGCCTCAGGGTTTGG + Intronic
1092821077 12:12354034-12354056 GCTCTCCAGGACACAACGATTGG + Intergenic
1092989360 12:13880153-13880175 CATCTCCAGGACCCAAGGCCAGG - Intronic
1095832713 12:46604469-46604491 CCACTAGGGGACCCAAGGATGGG + Intergenic
1096258696 12:50077903-50077925 CCTCTCCTGGAAATAAGCATAGG - Intronic
1096316215 12:50568561-50568583 CCTGGCTTAGACCCAAGGATGGG - Intronic
1096386500 12:51198201-51198223 CATCTCCTGGCCCCAGGGAGGGG - Intronic
1096756761 12:53806085-53806107 ACTCTCCTGGATGCCAGGATAGG + Intergenic
1101346316 12:103889465-103889487 CTTCTCCTGGACCCACTGTTTGG + Intergenic
1102219077 12:111182215-111182237 CCTCCCCGGGGCCCTAGGATGGG - Intronic
1104983234 12:132583102-132583124 GCTCTCCTTGACCCGAGGTTCGG - Exonic
1105424454 13:20282787-20282809 CCCCTCCTGGCCTCAAGGAGGGG - Intergenic
1110800852 13:79692939-79692961 CTTCTCCTGCATCCAAGGAAAGG - Intergenic
1113596988 13:111540314-111540336 CCTCTCCTGGGCACAAGCATCGG - Intergenic
1124972663 15:34504490-34504512 CCTCTCCTTGTTCCCAGGATAGG + Intergenic
1125207247 15:37167609-37167631 CCTCTCCTGCAGCAAAGGCTGGG + Intergenic
1127840383 15:62826577-62826599 CCTCTGGAGGACCCATGGATGGG - Intronic
1128312928 15:66642819-66642841 CCTCTCTTGGAAACAAGGGTTGG + Intronic
1128519238 15:68364670-68364692 CCTCTCCTGACCCCAAGCAGTGG + Intronic
1128542093 15:68543351-68543373 TCTCTCCTGGACCAAAGCCTAGG + Intergenic
1130621882 15:85471683-85471705 GCTTGCCTGGACCCAGGGATGGG - Intronic
1131010199 15:89011084-89011106 CCGCGCCTGGCCCCAAGGCTGGG - Intergenic
1131034140 15:89210211-89210233 ACTGTCCTGGACCCAAGGCTAGG - Exonic
1131832916 15:96365808-96365830 CTTCTCCTGGACACCAGGACGGG - Intergenic
1132187740 15:99817172-99817194 CCTCTCCTTGTTCCCAGGATAGG - Intergenic
1132689516 16:1176336-1176358 TCACAGCTGGACCCAAGGATGGG - Intronic
1132760642 16:1507115-1507137 CCTCACCTGCGCCCAGGGATGGG + Intronic
1133045932 16:3088289-3088311 CCTCTTGTGGACCCCAGGAAAGG - Intergenic
1133771416 16:8868933-8868955 CTTCTCGGGGACCCCAGGATAGG - Intronic
1135810261 16:25580334-25580356 TCTCACCTGGAACCAAGGCTTGG - Intergenic
1138100348 16:54247070-54247092 CTTCTCCTGGCTCCAAGGGTGGG + Intronic
1138605863 16:58088357-58088379 CCTTTCCTGGAACAAAGGCTGGG + Intergenic
1140188336 16:72794060-72794082 CCTCTTCTGCACCCAACGAAGGG - Exonic
1140349469 16:74248333-74248355 ACTCATCTGGCCCCAAGGATCGG + Intergenic
1141221061 16:82069721-82069743 CCCATCCTGGACCCCAGCATAGG - Intronic
1144305967 17:13969836-13969858 CCTCACCTGGAGGCAAGGAGTGG - Intergenic
1145875329 17:28314918-28314940 CCTCTCCTGGGCCCTGGGTTTGG + Intergenic
1146693591 17:34892932-34892954 CCTCTCCTGGCCCCATGGGGAGG - Intergenic
1147645039 17:42028233-42028255 CCTCTCCAGGAGCCAAGCACCGG - Exonic
1147782884 17:42956315-42956337 ACTCACCTGGACTCAAGGAGAGG + Exonic
1151536503 17:74741900-74741922 CCTCTCCTGGAGCCTAGCCTTGG - Intronic
1156060099 18:33063571-33063593 CCTCTCAGGGGCCCAAGGGTTGG + Intronic
1156135567 18:34032788-34032810 CCACTCTGGGACCCAAGGACAGG + Intronic
1156838678 18:41585748-41585770 CCACTCCTGGCCTCAGGGATGGG - Intergenic
1157417825 18:47520820-47520842 GCTCTCATGGACCAATGGATTGG - Intergenic
1157489317 18:48111217-48111239 CCTCTTATGGACCCTAGAATGGG + Intronic
1158781270 18:60654770-60654792 CCTCTTCTGGGCCAGAGGATGGG - Intergenic
1158953404 18:62518454-62518476 CCTTTGCTGGAGCCATGGATAGG - Intergenic
1160974683 19:1787020-1787042 CCTCTCCCCGCCCCAAGGAGCGG + Intronic
1161116435 19:2499436-2499458 CAGCTCCATGACCCAAGGATGGG + Intergenic
1161231437 19:3176894-3176916 CCTCCCTTGGACCCCAGGACAGG + Intronic
1161847380 19:6719494-6719516 CCTCTCCAGGACCAGAGGCTGGG - Intronic
1162450287 19:10750142-10750164 CCTGGCCTGGGCCCATGGATAGG + Intronic
1162838773 19:13340347-13340369 CCTCTCATGAACCCCAGGAGTGG + Intronic
1163821769 19:19500104-19500126 CCTCTCCTGTTGCCAAGGATAGG + Intronic
1163831881 19:19550882-19550904 CCTGTGCTGGGCCCCAGGATGGG - Intergenic
1164479432 19:28600026-28600048 CCTTAACTGGCCCCAAGGATGGG + Intergenic
1164550852 19:29211403-29211425 CACCTCCAGGTCCCAAGGATGGG + Intronic
1164580093 19:29429576-29429598 CCTGCCCTGGACCAAGGGATGGG + Intergenic
1166985929 19:46660148-46660170 GCTCTCCTTGACCCAAGGGGAGG - Intronic
927462879 2:23314082-23314104 CTTCTCCTGGGCCCAAGCAGAGG - Intergenic
928217336 2:29372588-29372610 CCTCACATGGACCCAGGGATAGG + Intronic
929228101 2:39531552-39531574 ACTCTCCTGGCACCAAGGAAGGG - Intergenic
931232356 2:60385583-60385605 CCTCTGATTGGCCCAAGGATTGG + Intergenic
931552518 2:63462343-63462365 CCTCTCCTCGACCCCATGACAGG - Intronic
934651113 2:96091869-96091891 CCTCTCCTGGAGCCATGGGTCGG + Intergenic
938606378 2:132897158-132897180 CCTCTCATGGAATCAAGGAAAGG - Intronic
939558329 2:143703781-143703803 CATCGCCTGGACCCTGGGATGGG + Intronic
939894568 2:147776012-147776034 CCACTCCTGGAACCATAGATGGG - Intergenic
943770236 2:191708641-191708663 CCGCTCCTGGACACAGTGATTGG + Intergenic
944499573 2:200345143-200345165 CCTCTTATGGACCTAGGGATGGG - Intronic
946706670 2:222465083-222465105 CCTCTGCTGCGTCCAAGGATAGG - Intronic
947836358 2:233178846-233178868 CCTCTCCTTGCTCCAAGGACTGG - Intronic
948945056 2:241215172-241215194 GGGCTCCTGGACCCAAGGCTGGG + Intronic
1169285280 20:4302345-4302367 CCCCTCCTGGACCCCAGGCTGGG - Intergenic
1169825163 20:9759682-9759704 GCTCTCCTGGTCCCATGCATGGG + Intronic
1170565745 20:17603096-17603118 CCTTCCCTGGACCTTAGGATTGG + Intronic
1170663379 20:18363986-18364008 CCACTCCATGGCCCAAGGATCGG + Intergenic
1170799466 20:19579112-19579134 CCACTCCTGGAGAAAAGGATAGG + Intronic
1172093830 20:32451080-32451102 GGTCTCCTGCAGCCAAGGATGGG + Intronic
1172950714 20:38721983-38722005 TCCCTCCTAGACCCAAGAATTGG + Intergenic
1173912749 20:46682459-46682481 CCTCTCTTGGCCCCATGGACTGG + Intronic
1174096950 20:48097200-48097222 CCACTCCTGGAGCCAAGGGTGGG + Intergenic
1174458925 20:50669252-50669274 CCTCTCCTGACCCCTAGGCTAGG + Intronic
1175967728 20:62667941-62667963 CCTCCCCTGGACCCTGGGAAGGG + Intronic
1178916153 21:36706524-36706546 CCTCATCTGGACCTAAGGAAGGG - Intronic
1179937482 21:44614471-44614493 CCTCGCCTGGGCCCTGGGATTGG - Intronic
1180131749 21:45831080-45831102 TCTCTCCTGGCCTCAAGGAAAGG + Intronic
1180964882 22:19782896-19782918 CCTCTCCTGGACTCCAGGGCTGG + Intronic
1181065559 22:20304122-20304144 CAGCCCCTGGCCCCAAGGATGGG - Intergenic
1183227981 22:36563381-36563403 CATCTCCTGACCCCAAGGACAGG + Intergenic
950090114 3:10289269-10289291 CCTCGCCTGGAGGCAAGGAGGGG - Intronic
951660742 3:25062747-25062769 CCTCTACTGGCCCCAAACATAGG - Intergenic
951745193 3:25970558-25970580 CCTCTGTTTGTCCCAAGGATGGG - Intergenic
952622172 3:35358904-35358926 CCTCTCAAGGACCCAAGTAATGG - Intergenic
952684803 3:36135236-36135258 CTTCTCCAGGACCCAAAGAATGG + Intergenic
952744059 3:36761657-36761679 ACCCTCCTGGATCCAAGGAAAGG + Intergenic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
953878350 3:46679078-46679100 CCTCCCTTGGAGCCAAGGAGTGG - Intronic
954156051 3:48685529-48685551 CCTCTCCGGGACCCGAGGCCAGG - Intronic
954337746 3:49929656-49929678 CCTCTGCCGGACCCATGGAGGGG + Exonic
961171444 3:124800545-124800567 CCTCACTTGGACCGAAGGCTTGG - Intronic
961432909 3:126895895-126895917 CCTCTGCTGCACCGAAGGACAGG + Intronic
966911486 3:184562473-184562495 CCGCTCCGGGGCCCAGGGATGGG + Intronic
967759010 3:193203043-193203065 TCTCTCTTGCACCCAAGAATAGG - Intergenic
968282704 3:197489338-197489360 CCTGACCTGGACCCAAGGCATGG + Intergenic
968526241 4:1059043-1059065 CTGCTCCTGGACCCCAGGATGGG + Intronic
968756198 4:2417728-2417750 TCTGCCCTGGACCCAGGGATTGG + Intronic
968974838 4:3816619-3816641 CCTGTGCTGGACCCAGGGGTAGG - Intergenic
975156695 4:71080273-71080295 CCTCTCCTGGAGTCAGGGCTGGG + Intergenic
978462851 4:108976666-108976688 CCTCCACTGGCCCCTAGGATGGG - Intronic
982422015 4:155208923-155208945 GCTGTCCTGGACCCTAGGAGGGG + Exonic
983660248 4:170124501-170124523 TCTCTCCTGGACCCAGGGAAAGG - Intergenic
984843104 4:184086584-184086606 AGTCACCTGGACCCAAGGCTTGG - Intergenic
986668482 5:10123700-10123722 CCTCCCCTGCACTCAAGGAAGGG + Intergenic
988148347 5:27340956-27340978 CCTCTCATGGTCTCATGGATAGG + Intergenic
989269572 5:39516512-39516534 ACTCTCCTGAACCCAAGAGTTGG - Intergenic
990033645 5:51292474-51292496 CCTCTCCTGACCCCAGAGATAGG + Intergenic
992157332 5:73968311-73968333 CCTGGCCCAGACCCAAGGATGGG - Intergenic
992762577 5:79963465-79963487 TCTGTCCTGGACCCAGGAATAGG + Intergenic
994059544 5:95459005-95459027 CCTCTCCTGAAGCAAAGGGTGGG + Intergenic
997024174 5:130038537-130038559 CCTACCCTGCACACAAGGATTGG + Intronic
997676946 5:135720215-135720237 GCTGCCCTGGACCCAAGAATGGG - Intergenic
998007225 5:138665132-138665154 CCTCAGCTGCCCCCAAGGATGGG - Intronic
999240182 5:150122961-150122983 CCCCTCCTGGACAAAAGGAGGGG + Intronic
999315476 5:150580742-150580764 CCTCTCCTCCACCCAATGAGGGG - Intergenic
999364023 5:151009676-151009698 CCTAACCTGGTCCCCAGGATAGG - Intergenic
999365655 5:151021739-151021761 CCTCTCCTCTACCCAGGGAGTGG + Intronic
1000661884 5:163948338-163948360 CTTCTCCTGGAGGCAGGGATCGG + Intergenic
1001255509 5:170180199-170180221 CCTTACAAGGACCCAAGGATGGG - Intergenic
1003942619 6:11044161-11044183 TCTCTCCTGGACCCACGCACCGG - Intronic
1005266032 6:24113102-24113124 CCCCCCCTGGACCGCAGGATGGG - Intergenic
1005611787 6:27532874-27532896 ACTGTCCTGGACCCCAGGACAGG - Intergenic
1007243885 6:40446207-40446229 CCACTCCTGAATCCAAGGCTGGG + Intronic
1008555629 6:52670892-52670914 CCTGTCCTGGAGCCAGGGCTGGG - Intergenic
1011314633 6:86017760-86017782 CCTCTCCTGCAACCCAGCATTGG - Intergenic
1012764928 6:103355801-103355823 CCTCTCCTGTGCCCTAAGATTGG + Intergenic
1013594728 6:111650146-111650168 CCACTCCATGACCCAAGGGTTGG + Intergenic
1014121277 6:117727922-117727944 CCTCTCCTGGAGCCAGGAGTTGG + Intergenic
1015819498 6:137245502-137245524 CATCTCCTGGTCCCAAGGGGTGG + Intergenic
1016941847 6:149488855-149488877 CCCCACCTGGACCCATGGATGGG - Intergenic
1018604256 6:165580209-165580231 TCTCTCCTGACCCCAAGTATTGG - Intronic
1018652433 6:166003296-166003318 CCTCCCCAGGACTCTAGGATGGG + Intergenic
1019575470 7:1735564-1735586 CCTCCCCTGGACAATAGGATGGG + Intronic
1019645209 7:2125226-2125248 CAGGTCCTGGACCCAAGGGTGGG + Intronic
1019918572 7:4149098-4149120 CATCTCCCTGACCCAAGGAAGGG + Intronic
1025745896 7:64242466-64242488 CCTTACCTGGACCTAAAGATTGG - Intronic
1026359655 7:69591643-69591665 CCATTCCTGGCCCCAAGGCTTGG + Intergenic
1027434580 7:78151435-78151457 CCTCTCCTGGAACCAACCCTTGG - Intronic
1027876047 7:83770024-83770046 CCTCTCTTGAACCAAAAGATTGG - Intergenic
1028959503 7:96732902-96732924 CCTCTTCTTGACCCCAGGAAAGG + Intergenic
1029376178 7:100178064-100178086 TTTCTCCTTGACCCAAGAATAGG + Intronic
1032085327 7:128880661-128880683 CCTCTCCTGCCCCCATGGCTGGG - Exonic
1032571975 7:133010258-133010280 CCCCTCCAGGATCCAAGGCTAGG - Intronic
1032855793 7:135832570-135832592 CCTCTGCAGGCACCAAGGATCGG + Intergenic
1034391290 7:150789652-150789674 CTTCTTCTGGACCAAAGGACAGG - Intergenic
1035394882 7:158528248-158528270 CCTGTCCTGCACCCAAGCACGGG - Intronic
1036089244 8:5647517-5647539 CCTTTCCTGGACCCAAGATCAGG + Intergenic
1037820013 8:22130887-22130909 TCTCTCCTGGGTCCCAGGATCGG - Exonic
1037911317 8:22745321-22745343 CCTCTGCGGGACCCAAGGCTGGG - Intronic
1038410436 8:27354333-27354355 CCTGGCCTGGACCACAGGATGGG - Intronic
1039458428 8:37723999-37724021 CCTCTCCTTGTCCCCAGCATAGG + Intergenic
1039836524 8:41260564-41260586 GCACTTCTGGACCCAAGGAGGGG + Intergenic
1041147381 8:54891350-54891372 CCTCTCCTGGTGACAAGGAAGGG + Intergenic
1043018334 8:74969064-74969086 CCTTTCCAGGACCCCAGGAAAGG + Intergenic
1043105291 8:76102040-76102062 CCACTCCTTGACCCTGGGATGGG + Intergenic
1046259627 8:111750907-111750929 CAACCCCTGGACCCAAGGACTGG + Intergenic
1048028431 8:130608339-130608361 CCTTTCCTGGAGTCAGGGATCGG + Intergenic
1049455868 8:142686944-142686966 CTTCTACTGGGCCCAAAGATGGG + Intergenic
1049646895 8:143739587-143739609 GCTCTTGTGGGCCCAAGGATGGG - Intergenic
1057294076 9:93825297-93825319 CCACTCATGGACCCAGGGAGAGG - Intergenic
1057961421 9:99461197-99461219 CCTCTCCAGGGCCCCAGGGTAGG - Intergenic
1059395600 9:114032320-114032342 GCTCTCCAGGAGCCAAAGATGGG + Intronic
1059420196 9:114185896-114185918 CCTCTGCTAGACTCAAGGGTGGG + Intronic
1060416399 9:123433864-123433886 CTTCTCCTGTGCCCAAGGATGGG - Intronic
1060481968 9:124021851-124021873 ACTCTCCTGGAAGCAAGGTTTGG + Intronic
1061034011 9:128103475-128103497 CCTCTCCAGGACCCCAGCAGGGG + Intronic
1062052053 9:134452438-134452460 TCTCTCCTGGAGCCAAGTACAGG - Intergenic
1062138215 9:134940846-134940868 CCTCTCCTTGACCCAGGGGGAGG - Intergenic
1186787717 X:12969062-12969084 CTTTTCCTGGACCCAGGAATGGG - Intergenic
1187070372 X:15881525-15881547 CTTCTCCTGGAGCCAAGCCTTGG - Intergenic
1189328703 X:40129708-40129730 CCACTCCTGCTCCCAAGGAAAGG - Intronic
1189332766 X:40153510-40153532 CCTTTCCTGCATCCAAGGAAGGG + Intronic
1190073945 X:47301808-47301830 TCTCTCCTGGATCCAGGGAAAGG + Intergenic
1193490403 X:82142598-82142620 CCTTTCCTGGCACCAAGGAAGGG - Intergenic
1195444598 X:104937541-104937563 CCACACCTGGATCCAAGGATTGG + Intronic
1197708884 X:129652544-129652566 CTTCTCCTGGAGCCAAGGAAGGG - Intronic
1198068564 X:133124884-133124906 TCTCTCCTGGATCCAGGGAAAGG + Intergenic
1200536364 Y:4402678-4402700 CCCCTCCTGGAACCAAGAAAGGG + Intergenic
1200904792 Y:8470901-8470923 CCTCTCCTGAAGCCAGGCATAGG - Intergenic