ID: 1063299711

View in Genome Browser
Species Human (GRCh38)
Location 10:4840589-4840611
Sequence GAAGGAATGAGGCCAGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 732
Summary {0: 1, 1: 0, 2: 6, 3: 69, 4: 656}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063299711_1063299722 24 Left 1063299711 10:4840589-4840611 CCTGCCTCTGGCCTCATTCCTTC 0: 1
1: 0
2: 6
3: 69
4: 656
Right 1063299722 10:4840636-4840658 TCAGCCACATGAAGCTGCTGTGG No data
1063299711_1063299715 -2 Left 1063299711 10:4840589-4840611 CCTGCCTCTGGCCTCATTCCTTC 0: 1
1: 0
2: 6
3: 69
4: 656
Right 1063299715 10:4840610-4840632 TCCCATCCCTGTGAACATCCTGG No data
1063299711_1063299724 26 Left 1063299711 10:4840589-4840611 CCTGCCTCTGGCCTCATTCCTTC 0: 1
1: 0
2: 6
3: 69
4: 656
Right 1063299724 10:4840638-4840660 AGCCACATGAAGCTGCTGTGGGG No data
1063299711_1063299723 25 Left 1063299711 10:4840589-4840611 CCTGCCTCTGGCCTCATTCCTTC 0: 1
1: 0
2: 6
3: 69
4: 656
Right 1063299723 10:4840637-4840659 CAGCCACATGAAGCTGCTGTGGG No data
1063299711_1063299717 -1 Left 1063299711 10:4840589-4840611 CCTGCCTCTGGCCTCATTCCTTC 0: 1
1: 0
2: 6
3: 69
4: 656
Right 1063299717 10:4840611-4840633 CCCATCCCTGTGAACATCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063299711 Original CRISPR GAAGGAATGAGGCCAGAGGC AGG (reversed) Intronic
900124556 1:1063749-1063771 GAAGGAAGGAGGCCTGAGGGAGG - Intergenic
900291375 1:1924970-1924992 GAAGGCATGAGGGCACACGCTGG + Intronic
900291379 1:1924996-1925018 GAAGGCATGAGGGCACACGCTGG + Intronic
900291397 1:1925100-1925122 GAAGGCATGAGGGCACACGCTGG + Intronic
900291421 1:1925210-1925232 GAAGGCATGAGGGCACACGCTGG + Intronic
900291438 1:1925316-1925338 GAAGGCATGAGGGCACACGCTGG + Intronic
900412141 1:2517474-2517496 GAAGGAATGAGCCCCGCGGGGGG + Intronic
900417290 1:2540939-2540961 GAATGAATGAGGGCGGCGGCGGG - Intergenic
900518953 1:3096422-3096444 GAAGGAATGAGGTCATGGGAGGG + Intronic
900604851 1:3519368-3519390 GAATGAAGGAGGCCAGACGGCGG + Intronic
901061917 1:6475530-6475552 GAAGCGAGGAGGGCAGAGGCTGG + Intronic
901167422 1:7230278-7230300 GCAGGAATGAGGCCGGGGTCTGG + Intronic
901288932 1:8106664-8106686 GAAGGCGTGAGGGAAGAGGCAGG - Intergenic
902488669 1:16764836-16764858 GAAGAGAGGAGGCCAGAGGGAGG - Intronic
902754665 1:18541126-18541148 GATGGGATGAGGCCAGAGGCAGG - Intergenic
902803089 1:18842767-18842789 GAAGGATGGTTGCCAGAGGCTGG + Intronic
902897669 1:19490223-19490245 GAAGGAATGACCCGCGAGGCAGG + Intergenic
903141260 1:21340450-21340472 GAAGGAGTGAGGCCGAAGGCTGG - Intronic
903420330 1:23214413-23214435 GAATGAATGATGACAGAGTCTGG - Intergenic
903456699 1:23492411-23492433 GAAGGGATGAGGTCAGAGGAAGG - Intergenic
903602574 1:24553551-24553573 GACAGAATGAGGTCAGAGGCAGG - Intergenic
903779652 1:25813169-25813191 GAAAAAATCGGGCCAGAGGCTGG + Intronic
904326706 1:29731232-29731254 GAATGACTGAGTCCAGATGCAGG + Intergenic
904615221 1:31745918-31745940 GAGTGGATGAGACCAGAGGCTGG - Intronic
905276119 1:36819344-36819366 GATGGAAGGAGACCAGAGGCAGG - Intronic
905654467 1:39677156-39677178 GAAGTAATTAGGACAGAGGAAGG - Intergenic
905805414 1:40873492-40873514 GATGAAGTGAGCCCAGAGGCAGG + Intergenic
906821214 1:48932126-48932148 GAAGCAATCAGGCCAGAAGAAGG - Intronic
908104393 1:60826297-60826319 GAAGGACTGTTGCCAGAGGCTGG - Intergenic
909484859 1:76161439-76161461 GAAGGACTGAGGGGAGCGGCAGG - Intronic
909746898 1:79108566-79108588 GGAGGAATGTGGCCAGAGATGGG + Intergenic
909825049 1:80117240-80117262 GAAAGAAAGAGGCCAGAGTCTGG + Intergenic
911113664 1:94219612-94219634 GAAGAAATGAGACAGGAGGCAGG - Intronic
911122815 1:94312887-94312909 GAAAGGATGAGGTCTGAGGCTGG - Intergenic
911197072 1:95005367-95005389 TAATGAAGGAGGCCAGAGTCAGG + Intronic
912525936 1:110282599-110282621 GCAGGCATGTGGCCAGAGGCTGG + Intronic
912681218 1:111730116-111730138 GAAGCAAAGAGGCCAGAGAGAGG - Intronic
912798183 1:112705411-112705433 GAAGGGAAGAGGCCTGGGGCTGG - Exonic
913374131 1:118132283-118132305 GAAGGACTGAGGCCAGAGAAAGG + Intronic
917264005 1:173200337-173200359 GAAGAAATGAGGTCAGAAGTAGG + Intronic
917963746 1:180165889-180165911 GAAGCCTTGAGGCCAGAGTCTGG - Intronic
917991519 1:180384974-180384996 GAAGGACTGATACCAGAGGCTGG + Intronic
918055741 1:181020533-181020555 GAGGAAATGAGACCAGAAGCAGG + Intronic
918149914 1:181789526-181789548 GAAGGACTGGGGTCAGTGGCTGG - Intronic
918298795 1:183183541-183183563 TAAGGGATGAGGCCAGAGCAGGG + Intergenic
918409253 1:184241396-184241418 GAAGGAAGGTTGGCAGAGGCTGG + Intergenic
919360673 1:196590534-196590556 AAAGGAATGAGGCTAGTGCCAGG - Intronic
919812088 1:201415095-201415117 AAAGGAAGGAGGCCAGAGTGAGG - Intronic
921495679 1:215838263-215838285 AAAGGAATGAGCTCAGAGGAAGG + Intronic
922024815 1:221740578-221740600 GCAGGAATGAGGGCGGGGGCAGG - Intronic
922029737 1:221786387-221786409 GGAGCAATGTGGCCAGAGGTGGG - Intergenic
922244227 1:223778948-223778970 GAAGGCAGGAGGGCTGAGGCAGG - Intergenic
922728238 1:227936028-227936050 GAAGGAGTGAGGGCAGAGCGTGG - Intronic
922878865 1:228964002-228964024 GAAGGAGTGAGGTTTGAGGCTGG + Intergenic
922907646 1:229186738-229186760 GAAGGGATGGGGCAGGAGGCAGG - Intergenic
923057781 1:230440447-230440469 GAAGAAATCAACCCAGAGGCCGG - Intergenic
923278026 1:232415460-232415482 TAAGGGGTGAGGCCAGAGGCTGG + Intronic
923531771 1:234817683-234817705 GAAGAGAGGAGGCCAGAGGGAGG + Intergenic
923691238 1:236195274-236195296 GAAGGATGGTTGCCAGAGGCTGG - Intronic
923782205 1:237035213-237035235 GAAGGGATGAGGACTGAGTCTGG + Intergenic
923851615 1:237802510-237802532 GAAGGGATAAGGATAGAGGCAGG - Intronic
924455892 1:244218607-244218629 TAAGGAGAGAGGCCAGAGGGAGG + Intergenic
924644368 1:245863712-245863734 GTCGTAATGAGGTCAGAGGCGGG - Intronic
1063105336 10:2987293-2987315 GAAGGAGGGAGGCGAGAGGAAGG - Intergenic
1063299711 10:4840589-4840611 GAAGGAATGAGGCCAGAGGCAGG - Intronic
1063556298 10:7082786-7082808 GAAGGAAAGAAGGCAGAGGAAGG + Intergenic
1063601053 10:7481923-7481945 GAAGGAATAACAGCAGAGGCTGG - Intergenic
1064250814 10:13705139-13705161 GAAGGAAGGAAGTCGGAGGCAGG - Intronic
1065111903 10:22448605-22448627 AAAGGAATGATGCCAAAGACTGG + Intronic
1065436467 10:25708252-25708274 GAAGGAGGGAGGCAGGAGGCGGG - Intergenic
1065753124 10:28906783-28906805 GAAGGCATGAGGTGAGAGGCAGG - Intergenic
1065982940 10:30920128-30920150 GATGGAAAGAGACCAGAAGCAGG - Intronic
1066283489 10:33941223-33941245 GAATGAAAGATACCAGAGGCTGG - Intergenic
1066454845 10:35564303-35564325 CAAGGAAGGAGGCCCGAGGAAGG - Intronic
1066514120 10:36136766-36136788 GAAGGATTGTTGCCAGAGGCTGG - Intergenic
1066571405 10:36776846-36776868 GAAAGAAAGAGGAAAGAGGCTGG - Intergenic
1066653166 10:37678783-37678805 GAATGAATGAGGCTGGAGGAAGG - Intergenic
1067015363 10:42753917-42753939 GAAGGAAAGAGGAGCGAGGCTGG + Intergenic
1067037522 10:42931324-42931346 GAATGAATGAGGCTGGAGGAAGG - Intergenic
1067085188 10:43234458-43234480 GATGGAAGGTGGCCTGAGGCAGG + Intronic
1067107420 10:43375447-43375469 GAATGACTGAGGCCCCAGGCTGG + Intronic
1067831534 10:49613712-49613734 TAAGGACTGCGGCAAGAGGCAGG - Intronic
1067941633 10:50661587-50661609 GAGGGAATGAGGACAGTGGAAGG - Intergenic
1069957386 10:72060443-72060465 GAAGGAAGGAGTTCAGAGGAAGG - Exonic
1070637444 10:78140551-78140573 CAGGGGATGAGGCCAGGGGCAGG - Intergenic
1070693078 10:78542175-78542197 GAAGTAGTGTGGCTAGAGGCGGG - Intergenic
1070697316 10:78572682-78572704 GAATGAATGAGGGCAAAGCCAGG - Intergenic
1070782968 10:79148124-79148146 GAAGGAAAGAGGGAAGAAGCAGG - Intronic
1071091193 10:81920424-81920446 GAAGGAAGGAGACTAGAGGGAGG - Intronic
1071485592 10:86099991-86100013 CAGGGAAGGAGGCCAGAGCCTGG + Intronic
1071868788 10:89768646-89768668 GAATTAAAGAGGCCAGAGACAGG - Intronic
1072198751 10:93140033-93140055 GAAGGCAAGAGGCCAGAGCAGGG - Intergenic
1073832469 10:107401622-107401644 GAAGGAAGGTGACCAGAGGCTGG - Intergenic
1074184586 10:111089434-111089456 GATGGATTGGGGCCAGAGACTGG + Intergenic
1074307615 10:112293350-112293372 CAACGAGTGAGGGCAGAGGCGGG + Intronic
1074775123 10:116762293-116762315 GAGGGATTGGGACCAGAGGCAGG - Intergenic
1074914502 10:117942383-117942405 CAAGGAATGAATCCAGAGGATGG - Intergenic
1075206394 10:120453148-120453170 GAAGGAATGTGGCGGGTGGCAGG + Intergenic
1075442475 10:122491116-122491138 AAAAGAATGAAGGCAGAGGCTGG - Intronic
1075914464 10:126155562-126155584 GAAGGAATGAGGTGGGAGGAAGG - Intronic
1076605331 10:131685655-131685677 GCAGGAATGAGAGCAGGGGCTGG - Intergenic
1076799599 10:132814518-132814540 GACGGCAGGAGGCCCGAGGCTGG + Intronic
1076990071 11:268161-268183 GAAGGGCTGAGGCAAGAGGAGGG - Intergenic
1077249292 11:1553962-1553984 GCAGGCCTGAGGCCAGAGCCTGG - Intergenic
1077474225 11:2778834-2778856 GATGGAAGCAGGCCAGAGCCAGG - Intronic
1077474819 11:2781400-2781422 GGAGGGTTGAGGCCAGGGGCAGG + Intronic
1077609535 11:3635920-3635942 GAAGGACAGGGGCCAGAAGCTGG - Intergenic
1078430947 11:11288046-11288068 GAAGGAAAGAGGCTAGAAACAGG - Intronic
1078436283 11:11328378-11328400 CAAGGAAAGAGGCCACAGGGAGG + Intronic
1078464667 11:11541421-11541443 GGAGGAATGAGGCTGAAGGCAGG - Intronic
1078736743 11:14027151-14027173 GAAGGAATGGGGTCAGGGGTGGG + Intronic
1078775357 11:14388953-14388975 GAAGGAAGGAGCCCAGGGCCTGG + Intergenic
1078897502 11:15609978-15610000 CAGTGAATGAGGCTAGAGGCAGG + Intergenic
1079050864 11:17157993-17158015 GAAGGGAAAAGTCCAGAGGCAGG - Intronic
1080533757 11:33201702-33201724 GAATGAATGATACCAGGGGCTGG - Intergenic
1080636146 11:34125368-34125390 GAAGGAGCAAGGCCCGAGGCAGG - Intronic
1080788687 11:35499737-35499759 GAAGTAAAGAGGGCAGAGGTGGG - Intronic
1081350985 11:42051910-42051932 GAATGAATGAGGCCAAATGAAGG - Intergenic
1081627846 11:44666207-44666229 GTAGGAATGGGGTGAGAGGCTGG - Intergenic
1081977677 11:47246037-47246059 GAAGGCCAGAGGCCAGAGGAGGG - Intronic
1083267340 11:61552804-61552826 GGAGGAAAGAGGCCAGAGAAGGG - Intronic
1083467959 11:62861556-62861578 GAAGGGAAGAAGCCAGAGCCAGG - Intronic
1083533287 11:63445009-63445031 GAAGGAAGGTTACCAGAGGCTGG - Intergenic
1083570932 11:63762153-63762175 GGAGGAGCGAGGGCAGAGGCGGG - Exonic
1083666058 11:64275384-64275406 GCAGGAATGTGGCCAGGGCCTGG - Intronic
1083778898 11:64907947-64907969 GCAGGACTGAGACCAGAGACAGG - Intronic
1084026144 11:66450978-66451000 GAAGGAATGAGGGAGGGGGCAGG + Intronic
1084381622 11:68816536-68816558 GAAGGAAGGCGGCCGGAGCCAGG - Intronic
1084496041 11:69504306-69504328 GGAGGGATGAGGCCAGACCCTGG - Intergenic
1084557845 11:69885583-69885605 GTAGGAATGAGGGCAGAGTGGGG + Intergenic
1084667038 11:70582075-70582097 GAAGAGCTGAGGCCAGAGGAGGG + Intronic
1084714804 11:70866939-70866961 GAGGGAGTGAAGGCAGAGGCTGG - Intronic
1084906668 11:72353708-72353730 GAAGGAAGGTGGCATGAGGCTGG + Intronic
1085051982 11:73384659-73384681 GGGGGAAGGAGCCCAGAGGCTGG - Intronic
1085052831 11:73388627-73388649 GCAGGAGTGAAGGCAGAGGCCGG + Intronic
1085324464 11:75595873-75595895 TACGGAAGGAGGCAAGAGGCAGG - Intronic
1085468805 11:76743622-76743644 GCAAGAACAAGGCCAGAGGCAGG - Intergenic
1085736078 11:79040409-79040431 GGAGGCAGGAGGCCGGAGGCTGG - Intronic
1086207295 11:84274881-84274903 GCAGGAATGAAGGCAGAGGAGGG - Intronic
1086902136 11:92379875-92379897 CAAGGAATCAGGCCATAGTCTGG + Intronic
1087117799 11:94543824-94543846 GAGGGAGGGAGTCCAGAGGCCGG - Exonic
1088443008 11:109892394-109892416 GCAGGAATGAGCCTACAGGCAGG + Intergenic
1088530235 11:110800134-110800156 GGATGAAGGAGGCCAGAGGGTGG + Intergenic
1088597226 11:111449566-111449588 AATGGAATGAGCCCAGTGGCTGG - Intronic
1088701518 11:112417179-112417201 GAAGCAATGAAGCAAGAGGTAGG + Intergenic
1088704824 11:112452564-112452586 GAAGGAACAAGACCAGAGGTAGG - Intergenic
1088892816 11:114058577-114058599 GAAGGTAGGGTGCCAGAGGCGGG - Intergenic
1089493187 11:118896116-118896138 GATGCAAAGAGGCAAGAGGCTGG + Exonic
1089907089 11:122051240-122051262 GAAGGAAGGTTACCAGAGGCTGG - Intergenic
1091042418 11:132294289-132294311 GAAGGAATGAGGGGAGGGGAAGG - Intronic
1091428828 12:414884-414906 GGATGTAAGAGGCCAGAGGCAGG - Intronic
1091702694 12:2674340-2674362 GAAGGAAGGTGGACAGAGGAAGG + Intronic
1091789578 12:3264166-3264188 GATGTAATGGGGCCAGAGGGAGG + Intronic
1092211180 12:6647335-6647357 GAGGGAAGGAAGCCAGCGGCTGG + Exonic
1092507571 12:9119708-9119730 GAAGGGATGATCCCAGAGGGAGG + Intergenic
1092862982 12:12735539-12735561 GAAGGAATGAGTGCTGTGGCTGG + Intronic
1093405693 12:18801450-18801472 TAGGGAATGAGGCCAGATTCTGG + Intergenic
1093559440 12:20520764-20520786 GGAGGAATGGGGTCAGAGTCAGG + Intronic
1093984508 12:25514484-25514506 GAAGGATGGTTGCCAGAGGCTGG + Intronic
1094294583 12:28889917-28889939 GAAGGATTGTTACCAGAGGCTGG - Intergenic
1094499413 12:31008915-31008937 GATGTAATGGGGCCAGAGGGAGG - Intergenic
1094568288 12:31619498-31619520 GAAGGAATGAAGAAAGAAGCAGG - Intergenic
1094677198 12:32632481-32632503 GAAGGAGAGAGGAGAGAGGCAGG + Intronic
1095143228 12:38692597-38692619 CAAGGAATGAACACAGAGGCAGG + Intronic
1096409870 12:51369294-51369316 AAGGGCTTGAGGCCAGAGGCTGG - Intronic
1096516380 12:52157884-52157906 GGAGGGATGAGGGGAGAGGCGGG - Intergenic
1096526180 12:52211727-52211749 GAAGGGATGTGGTCAGATGCAGG + Intergenic
1096772491 12:53944954-53944976 GAAGAAGTGAGGCAAGCGGCTGG - Intronic
1096849301 12:54425504-54425526 CAAGGACTGAGGCCAGAGGTCGG - Intergenic
1097637284 12:62138177-62138199 GAAAGGATGAGGCAAGAGGATGG + Intronic
1097682239 12:62659692-62659714 CAGGGAATGAGGCCTGAGACAGG - Intronic
1098181534 12:67852395-67852417 AAAGGGATGAGGCCAGTGGAGGG + Intergenic
1099917196 12:88909226-88909248 GAATGAAAGATACCAGAGGCTGG - Intergenic
1100106696 12:91183805-91183827 GAAGGAAGGAGGCTGGAGGATGG - Intergenic
1100316588 12:93450301-93450323 GAATGCATGAGGCCAGAGGCAGG + Intergenic
1101289623 12:103354413-103354435 CAAAGACTGAGGCCAGAAGCTGG + Intronic
1101642829 12:106601065-106601087 GAAGGAATGAAAGCAGAGGCAGG + Intronic
1101937745 12:109071827-109071849 GTGGGAATGAGGCCAGGGGAGGG + Intronic
1102031365 12:109741830-109741852 TAAGGAGGGAGGTCAGAGGCTGG - Intronic
1102562706 12:113773804-113773826 CAATCAATGAGGCCAGGGGCTGG + Intergenic
1103613565 12:122138477-122138499 GCAGGAGAGAGGCCAGATGCAGG + Exonic
1103719152 12:122964243-122964265 GAAGGAATTCCCCCAGAGGCTGG - Intronic
1104049128 12:125184743-125184765 GAAGGAAGAAAGCCAGGGGCAGG - Intergenic
1104205745 12:126636603-126636625 GGAGGAATCAAGCCAGGGGCTGG - Intergenic
1104807462 12:131598787-131598809 GCAGGGCTGAGGTCAGAGGCTGG - Intergenic
1106388934 13:29316530-29316552 GAAGGAAAGAAGCAAGGGGCAGG - Intronic
1106744100 13:32681324-32681346 GAAAGAGTGAGGCTTGAGGCTGG + Intronic
1106795248 13:33198438-33198460 GAAGGAAGGAGGCTTTAGGCAGG - Intronic
1107111624 13:36704238-36704260 GAGAGAAAGAGGCCAGAGACTGG + Intergenic
1108027845 13:46197137-46197159 AAAGGAATGAGACCATAGGAGGG + Intronic
1109623014 13:64934589-64934611 GGAAGAAGGATGCCAGAGGCAGG - Intergenic
1109925129 13:69127070-69127092 GAATGAATGAGGACTGAGGATGG - Intergenic
1110238896 13:73245092-73245114 CAAGGAATGGGGGCTGAGGCAGG + Intergenic
1112030969 13:95456073-95456095 GACTGCATCAGGCCAGAGGCAGG + Intronic
1112483426 13:99798155-99798177 GAAGGAGGGAGGGAAGAGGCAGG + Intronic
1112624691 13:101090848-101090870 GAAGGAAGGAGGTCATAGGTTGG - Intronic
1112774382 13:102828428-102828450 ACAGGAATGAGGCCAGAGACGGG - Intronic
1112986436 13:105455897-105455919 GAATGATAGATGCCAGAGGCTGG + Intergenic
1113055552 13:106263239-106263261 GAGGGGCTCAGGCCAGAGGCAGG - Intergenic
1113794062 13:113046563-113046585 GAAGGAATGAGGCAATGTGCGGG - Intronic
1113964581 13:114145487-114145509 GGAGGAAGGAGGGCAGGGGCTGG + Intergenic
1113979460 13:114261481-114261503 GAAGCAGTGAGGTCAGGGGCTGG + Intronic
1114762896 14:25336835-25336857 GAATGATTGATACCAGAGGCTGG + Intergenic
1116039691 14:39670590-39670612 GAGGGAAAGATGGCAGAGGCTGG + Intergenic
1116269683 14:42745571-42745593 GAAGGATGGATACCAGAGGCTGG + Intergenic
1116456439 14:45125749-45125771 GAAGCAATGAGCCCAGGAGCTGG + Intronic
1116576738 14:46584962-46584984 GAGAGAAAGAGGCCAGAGACTGG + Intergenic
1117348504 14:54857986-54858008 GCAGGAATGAGGTCAGAAACTGG + Intronic
1117496933 14:56314721-56314743 GAAGGAATGAGGGAAAAGCCTGG - Intergenic
1118283177 14:64447604-64447626 TTAGGAATCAGGCCAGTGGCTGG - Intronic
1119046095 14:71320394-71320416 GAAGGAATGGGGCGGGAGGCGGG + Intergenic
1119182321 14:72613559-72613581 GAAGGAGTGGGGACAGAAGCTGG + Intergenic
1119921550 14:78451015-78451037 TAAGGAATGAGGGCAGAGATGGG + Intronic
1120749017 14:88180394-88180416 ATGGGAAGGAGGCCAGAGGCTGG + Intronic
1121519914 14:94578982-94579004 GAAGGAATCAGGACTGAGGGTGG - Intronic
1121888060 14:97562638-97562660 GAAGGAAGGAGGAAAGAGGGAGG + Intergenic
1122204892 14:100143420-100143442 GCAGCAGTGAGGCCACAGGCAGG + Intronic
1122414725 14:101543390-101543412 GCAGGGATGCGTCCAGAGGCAGG + Intergenic
1122919393 14:104873853-104873875 GAAGCACTGAGGCCTGGGGCCGG - Intronic
1124370640 15:29103138-29103160 GGCGGAATGAGGCCAGGAGCAGG + Intronic
1124423267 15:29540408-29540430 GAAAGAAAGAGGCCAGTGGAAGG + Intronic
1124503949 15:30255675-30255697 GGAGGAACGAGCCCAGAGCCTGG - Intergenic
1124623404 15:31293137-31293159 AGGGGAATGAGGCCAGAAGCCGG - Intergenic
1124739605 15:32282965-32282987 GGAGGAACGAGCCCAGAGCCTGG + Intergenic
1125204009 15:37130583-37130605 GAAAGAATGAGACCAGGGGATGG - Intergenic
1125600163 15:40911254-40911276 GAAGGAAGGAGGGGAGGGGCTGG - Intergenic
1125724268 15:41860449-41860471 CAAGGACTGAGGTCAGATGCCGG - Intronic
1125766074 15:42137421-42137443 GAAGCGCTGAGGCCAGAGGGAGG + Intergenic
1125886107 15:43230796-43230818 AAAGAAATGAGGCAAGAGCCAGG - Intergenic
1126444440 15:48726776-48726798 CAAGGAACAAGGCCAGAGCCAGG - Intronic
1128334166 15:66775502-66775524 GGAAGACTGAGGCCAGAGGAGGG + Intronic
1128372957 15:67053891-67053913 AGAGGGATGAGGCCAGAGGTAGG + Intergenic
1128549159 15:68586692-68586714 GAAGGAAAGAGGCCAGAATCCGG - Intronic
1128733437 15:70035680-70035702 GAAGGAAAGAGGGAAGAGGGAGG + Intergenic
1128993667 15:72280927-72280949 GAGGGCAGGAGGCCAGAGTCTGG + Intronic
1129107729 15:73320859-73320881 GAAGGTGTGTGGCCAGAGGTGGG - Exonic
1129122152 15:73405522-73405544 GAAGAATGGTGGCCAGAGGCTGG - Intergenic
1129135773 15:73549344-73549366 GAAGGATGGTTGCCAGAGGCTGG + Intronic
1129318722 15:74762062-74762084 AAAGAGATGAGACCAGAGGCTGG + Intergenic
1129481716 15:75831751-75831773 GAAAGAATGAGGCCGTAGGAGGG - Intergenic
1129538115 15:76330546-76330568 GAAGGGATGAGGCCATGGGAAGG - Intergenic
1129962181 15:79697351-79697373 GAAGGAAAGAGGGCAAAAGCTGG - Intergenic
1130227020 15:82066724-82066746 GAAAGCATGGGGCCAGAGGAGGG + Intergenic
1130820214 15:87487249-87487271 GAAGGACTGAGGGAAGACGCTGG + Intergenic
1130964811 15:88689322-88689344 GATGGCATGAGGCAAGAAGCTGG - Intergenic
1131223822 15:90607661-90607683 GGAGGAAGCAGGGCAGAGGCAGG - Intronic
1132100350 15:99018609-99018631 AAAGGAAAGAGGCCAGGGGCGGG + Intergenic
1132175242 15:99708889-99708911 GAAGGAATGGGGACAGAGCGTGG + Intronic
1132270481 15:100519947-100519969 GGAGAAGTGAGGCCAGAGGAGGG - Intronic
1132523422 16:401825-401847 GAAGCAATCAGGGCAGGGGCGGG + Exonic
1132873625 16:2126246-2126268 GCAGGAATGAGGCCAGCGCTGGG - Intronic
1133211118 16:4263951-4263973 GAAGCCATCAGGCCAGGGGCGGG - Intronic
1133642026 16:7726321-7726343 GAAGGATTGAGTCCAGAAGTTGG - Intergenic
1133975634 16:10598279-10598301 GTTGGAAAGAGGCCAGAGCCAGG - Intergenic
1134135600 16:11674595-11674617 GAAAGAATGACGCCAGAAGTTGG - Intronic
1134332348 16:13262705-13262727 GAAGGAAAGAAGGAAGAGGCAGG + Intergenic
1134552712 16:15145420-15145442 GCAGGAATGAGGCCAGCGCTGGG - Intergenic
1134677186 16:16098936-16098958 CATAGAATGAGGCCAGAGACGGG + Intronic
1135111404 16:19693239-19693261 GAATGATTGATACCAGAGGCTGG + Intronic
1135175241 16:20221971-20221993 AAAGGAAAGAGGAAAGAGGCAGG - Intergenic
1135393995 16:22117086-22117108 GCAGGGATGAGGCCAGGGTCAGG - Intronic
1135876426 16:26204584-26204606 GAAGGATGGTTGCCAGAGGCTGG + Intergenic
1135918137 16:26624415-26624437 GAGGGGAGGAGGCAAGAGGCAGG + Intergenic
1136045207 16:27609967-27609989 GAAGGAATGGGGCCTGAGGTGGG + Intronic
1136234150 16:28904142-28904164 GAAGGGATGAGGCAGGCGGCAGG - Intronic
1136524593 16:30820917-30820939 GCAGGAATGAAGGCAGAGGTGGG + Intergenic
1137545707 16:49401736-49401758 TAAGGCATGAAGCCAGTGGCTGG + Intergenic
1137977228 16:53042171-53042193 GGAGGAATGAGGGATGAGGCAGG - Intergenic
1138066490 16:53946781-53946803 GTAGGAAAGAGGCCAGAGCTGGG - Intronic
1140837570 16:78809505-78809527 AAAGGAATACTGCCAGAGGCTGG - Intronic
1141272070 16:82550096-82550118 GAAGGAATGTGCCCAGAGCGTGG + Intergenic
1141380172 16:83569172-83569194 GAAGGAAAGAGTGCAAAGGCTGG - Intronic
1141469873 16:84230959-84230981 GGAGGAATGAGGGCAGACACTGG + Intronic
1141630901 16:85287447-85287469 GAGGAGATGAAGCCAGAGGCGGG - Intergenic
1141713989 16:85716539-85716561 GAGGGAAGGAGGACAGAGGGAGG + Intronic
1142467893 17:146515-146537 GAAGGTGTGAGGCTCGAGGCAGG - Intergenic
1142604917 17:1076294-1076316 GAAGGAATGAGGCCAGTCTTGGG + Intronic
1142694591 17:1626863-1626885 GAGGGTAGGAGGCTAGAGGCTGG + Intronic
1142978913 17:3660390-3660412 CAGGGCACGAGGCCAGAGGCTGG - Intronic
1143496028 17:7313066-7313088 GAAGCAAGGAGTCCAGGGGCTGG + Exonic
1143854302 17:9837279-9837301 GAAGGATGGTTGCCAGAGGCTGG - Intronic
1144348085 17:14367971-14367993 AAAGGAAAAAGGCCAGGGGCAGG - Intergenic
1144826714 17:18109269-18109291 TGGGAAATGAGGCCAGAGGCTGG + Intronic
1144855604 17:18265693-18265715 AAAGGAAGGATACCAGAGGCAGG - Exonic
1145247908 17:21281866-21281888 GAAGGATTGTGGCCAAAGTCAGG - Intergenic
1146056518 17:29584059-29584081 GCTGGCAGGAGGCCAGAGGCAGG - Intronic
1146178100 17:30679578-30679600 GAAGGCAGGAGGACAGAGGAGGG + Intergenic
1146521501 17:33528946-33528968 GAGGAAAAGAGGACAGAGGCAGG + Intronic
1146626908 17:34441893-34441915 GAAGAGATGAGGACAAAGGCCGG - Intergenic
1147121745 17:38339185-38339207 AAAGGAATGAGGGCAGGAGCAGG + Intronic
1147218622 17:38915163-38915185 GGAGGGGAGAGGCCAGAGGCAGG + Intronic
1147587345 17:41660101-41660123 GGAGGAATGGGGCCAGGGGCAGG - Intergenic
1148050304 17:44766838-44766860 AATGGGATGAGGTCAGAGGCAGG + Intronic
1148549159 17:48540032-48540054 GAAGGAATCAGGACTGATGCAGG + Intergenic
1149411871 17:56417037-56417059 GAAGGATTGTTACCAGAGGCTGG + Intronic
1149437480 17:56645295-56645317 GAGGGGATGAGGGCAGAGGTGGG - Intergenic
1149638387 17:58187586-58187608 GAAGAGGTGAGGGCAGAGGCTGG + Intergenic
1149762242 17:59242900-59242922 GAAAGAATCTGTCCAGAGGCTGG + Intronic
1150298211 17:64026308-64026330 TTAGGAAAGATGCCAGAGGCAGG + Intergenic
1150918708 17:69461368-69461390 GAAAGAATGAGGGCAGTGACTGG + Intronic
1151334448 17:73431786-73431808 GAAGGAATGAGGACAGATGGCGG + Intronic
1151623537 17:75262023-75262045 GAAGGAAGGGGGCCACAGGCAGG + Intronic
1151775750 17:76200538-76200560 GAATGGTGGAGGCCAGAGGCTGG + Intronic
1152173367 17:78769281-78769303 AGAGGGAGGAGGCCAGAGGCAGG - Intronic
1153120964 18:1726306-1726328 GAAGGATGGTTGCCAGAGGCTGG - Intergenic
1153733045 18:8034819-8034841 GACAGAATGAGGACAGAGACAGG - Intronic
1154383478 18:13872629-13872651 GAGGGAATGGGACCTGAGGCGGG - Intergenic
1155029169 18:21969229-21969251 AAAAGAATGGGGCCTGAGGCGGG + Intergenic
1155280673 18:24236371-24236393 GAGGAAATGGGGACAGAGGCTGG + Intronic
1155535460 18:26811846-26811868 GAAGGAAGGTGCCCAGGGGCAGG + Intergenic
1156190974 18:34720092-34720114 AAGGGAATCAGGCCAGAGGCTGG + Intronic
1156368751 18:36453697-36453719 CTTTGAATGAGGCCAGAGGCTGG + Intronic
1156976929 18:43233884-43233906 GAAGGAAGGTTACCAGAGGCTGG - Intergenic
1157547337 18:48555630-48555652 AAAGAAATGAAGCCAGAGGCTGG - Intronic
1157562641 18:48659621-48659643 GAGGGAATGAGGCAGGAGGCCGG + Intronic
1158066723 18:53419456-53419478 GAAGGATGGTGACCAGAGGCTGG - Intronic
1158305733 18:56103378-56103400 GAAGGAGAGAGGTCAGAGGAAGG + Intergenic
1158403519 18:57141454-57141476 GAAGGAAATAGGCCTGAGGGTGG + Intergenic
1158622990 18:59048584-59048606 GGAGGAATGAGGTCAGAGACGGG + Intergenic
1159023556 18:63162789-63162811 GAAGGAAGGAGGGCAGAGTTTGG - Intronic
1159416078 18:68151232-68151254 GAAGGATTGTTGCCAGAGGCTGG + Intergenic
1159438580 18:68448661-68448683 GAAGGAGAGAGTACAGAGGCTGG - Intergenic
1159804827 18:72943567-72943589 TAAGGATTGTGGCCAGTGGCAGG + Intergenic
1160129537 18:76212510-76212532 AAAGGGATGAGGCAAGTGGCAGG - Intergenic
1160202328 18:76806227-76806249 GAGAGAATGAGGCCTGAGGTGGG + Intronic
1160620907 18:80169918-80169940 GAAGGAAGGAGGGAAGAAGCCGG + Exonic
1161759477 19:6160801-6160823 GAAGAAAAGAGGCTGGAGGCTGG + Intronic
1162141899 19:8590075-8590097 GGAGGAGGGAGGCTAGAGGCAGG + Intronic
1162307246 19:9882613-9882635 GTAGGAATGTGGTCAGGGGCTGG + Intronic
1162342373 19:10099214-10099236 GAAGGATTCAGGGCAGAGGAGGG - Intronic
1162742977 19:12783632-12783654 GCAGCAATGAGGGCAGAGACAGG - Intronic
1162949523 19:14062218-14062240 GCAACAAAGAGGCCAGAGGCTGG - Intergenic
1163032890 19:14555920-14555942 GGAGGAGTGAGGGCAGAAGCTGG - Intronic
1163131614 19:15276947-15276969 CAGAGAATGAGACCAGAGGCGGG + Intronic
1163664032 19:18594731-18594753 GAATGAGAGAGGCCAGAGCCGGG + Intronic
1164702479 19:30295663-30295685 CACGGAATGACCCCAGAGGCAGG - Intronic
1165389231 19:35528785-35528807 GAATGAGTGAGGGCAGGGGCTGG - Intergenic
1165826106 19:38706710-38706732 TAAAGGAAGAGGCCAGAGGCAGG - Intronic
1165891294 19:39113797-39113819 GAAGGATGGTGACCAGAGGCTGG + Intergenic
1165982690 19:39738042-39738064 TCAGGAATAAAGCCAGAGGCAGG - Intergenic
1166530871 19:43542823-43542845 GAGGGAATCAGGGCAGAGGATGG - Intergenic
1166792984 19:45408857-45408879 GAAGGGATGGAGCCAGAGGAGGG + Exonic
1167375405 19:49108292-49108314 GCAGGGATGAGGCCCGAGGTGGG + Exonic
1167423982 19:49420314-49420336 GAGAGAATGAGGCCTGAGGCAGG + Intergenic
1167500168 19:49841822-49841844 CAAGGAATGAGGCCAGATCTAGG + Intergenic
1167555533 19:50192925-50192947 GAATGAATGAGGCGAGAGCTAGG + Intronic
1167680370 19:50916519-50916541 GAGGGAATGCGGCCACAGACGGG + Intergenic
1167789675 19:51666449-51666471 GTAGGAAAGAGGCCAGATGTGGG + Intergenic
1167921956 19:52789292-52789314 GTAGGGAGGAGGACAGAGGCAGG + Intronic
1167987412 19:53330416-53330438 GCAGGAATGTGGCCAAAGGTGGG - Intergenic
925199279 2:1953020-1953042 GAAGGAAAGAGGAAAGAGGAAGG - Intronic
925232776 2:2250490-2250512 GAAGGAATGTTACCAGAGGCTGG + Intronic
925327311 2:3033384-3033406 CAAGGAGCGAGGTCAGAGGCAGG - Intergenic
925776243 2:7338701-7338723 GAAGGACGGTTGCCAGAGGCTGG - Intergenic
925955955 2:8964143-8964165 GAAGGAATAGGGCCAGAGGAGGG - Intronic
926252282 2:11161914-11161936 GGAGGAAGGAGGGCAGAGCCAGG + Intronic
926503622 2:13684034-13684056 GAGAGAAAGAGGCCAGAGACTGG - Intergenic
927038357 2:19203857-19203879 TAAGAAATGAGGACTGAGGCCGG + Intergenic
927159536 2:20244007-20244029 GAAGGCATGAGGTCCTAGGCGGG - Intergenic
927646264 2:24878901-24878923 GAAGGAGTGAGGACAGAGAAGGG - Intronic
928927929 2:36597737-36597759 GGAGGAAGGAGGCGAGAGGGCGG + Intronic
929086451 2:38172337-38172359 GAAGGAAGGAGGCAGGAGGAAGG - Intergenic
929228170 2:39531969-39531991 TTAGAAATGAGGCCTGAGGCTGG - Intergenic
929395857 2:41521459-41521481 GAAGGAGTGAGGCTGGAGGAAGG - Intergenic
929487794 2:42370251-42370273 GGTGGAAGGAGGCCGGAGGCTGG + Intronic
929532421 2:42761465-42761487 GAAGGAGTGAGGGCAGGTGCTGG + Intergenic
929760214 2:44800682-44800704 GCAGAAGTGAGGCCAGAGGCTGG - Intergenic
930733416 2:54750612-54750634 GAAAGAATGAGGCCAACGACCGG - Intronic
932264216 2:70353099-70353121 GAGGAAATGAGGCCACCGGCAGG + Intergenic
932691728 2:73919253-73919275 GAAGGAATAAGGGAAGAGGGGGG + Intronic
932720952 2:74138744-74138766 GCTGGAAAGAGGCCGGAGGCAGG + Intronic
932822873 2:74916186-74916208 GAAGAAGTGAGGCCCAAGGCTGG - Intergenic
932874726 2:75439210-75439232 GAAGGAATGAGCCCAGAGAGGGG + Intergenic
933286640 2:80391329-80391351 GATGGAATAAGCCCAGAGTCTGG + Intronic
933531891 2:83521067-83521089 GAAAGAAGGAGGCCCCAGGCAGG - Intergenic
933547450 2:83732637-83732659 GAAGAAATGAAGACATAGGCAGG - Intergenic
933871579 2:86571116-86571138 GAAGGATGGTGACCAGAGGCTGG + Intronic
934990109 2:98914750-98914772 CATGGACTGAGGCCTGAGGCTGG + Intronic
935749475 2:106218420-106218442 GAAGGATGGTGACCAGAGGCTGG + Intergenic
935808025 2:106768090-106768112 GAAGGCAGGAAGCCAGAGCCTGG - Intergenic
935826557 2:106957111-106957133 GGAGGAATCAGGCCAGAATCAGG - Intergenic
936121819 2:109752886-109752908 GAAGGATGGTGACCAGAGGCTGG - Intergenic
936222876 2:110618586-110618608 GAAGGATGGTGACCAGAGGCTGG + Intergenic
936500410 2:113062099-113062121 GTGGGAAAGAGGCCAGATGCAGG - Intronic
937282965 2:120733017-120733039 GAAGGAATGAGGAATGAGGGAGG - Intergenic
937312576 2:120911108-120911130 GAAGAAATGAGGCCGGGGGAAGG - Intronic
937430065 2:121830937-121830959 GCAGTAATGAGGGCAGAGGTGGG + Intergenic
937815637 2:126247763-126247785 GGAGGTTTGAGGACAGAGGCAGG - Intergenic
937868873 2:126773439-126773461 CAAGGAAACAGGCCAGAGGGGGG - Intergenic
938093204 2:128446651-128446673 GAAGGAAGGAGGAGAGAGGGTGG + Intergenic
938398580 2:130968579-130968601 CAAGAAATGAGGCTAGAGACAGG + Intronic
938666665 2:133545754-133545776 GAAGGGAGGAGGGGAGAGGCAGG + Intronic
941952025 2:171165614-171165636 CAAGAAATTAGCCCAGAGGCTGG + Intronic
942775060 2:179571813-179571835 GTAGGAATATGGCCAGAGGAGGG - Intronic
942921304 2:181376584-181376606 ACAGGAAGGAAGCCAGAGGCAGG + Intergenic
943170473 2:184391278-184391300 GAAGGAAGGTTGACAGAGGCTGG + Intergenic
945160471 2:206885164-206885186 GTAGGAATGAGGCAGGAGGAAGG - Intergenic
945364391 2:208933552-208933574 GAAGGATGGTTGCCAGAGGCTGG - Intergenic
946311532 2:218884753-218884775 GAAGGAAGTAGACCAGGGGCTGG - Intronic
946567190 2:220979698-220979720 GACAGAATGATGCCAGAGGGTGG + Intergenic
947400858 2:229730368-229730390 GAAGGAATGAATCCAGTGGTAGG - Intergenic
947481833 2:230507791-230507813 GAAGTCATGAGGCCAGAGGAAGG + Intronic
947533762 2:230928276-230928298 GAAGGAATGAGGGCAGGAGTGGG + Intronic
947712858 2:232325882-232325904 GAAGGTATGAGGCCAGGGCAGGG + Intronic
947810524 2:233001135-233001157 GGAGGAATCAACCCAGAGGCTGG + Intronic
948097784 2:235350190-235350212 GAATGAAGGAGGCAACAGGCAGG + Intergenic
948577673 2:238965062-238965084 GGAGGGAGGAGGCAAGAGGCAGG - Intergenic
948577729 2:238965253-238965275 GGAGGAAGGAGGACAGAGGAGGG - Intergenic
948780554 2:240319131-240319153 GAGGGAATGAGGCTGGAGGAGGG + Intergenic
948901086 2:240957223-240957245 GAAGGACAGAGGCAGGAGGCAGG - Intronic
948981954 2:241498960-241498982 GAAGGGACCGGGCCAGAGGCGGG + Intronic
949072923 2:242036961-242036983 GAAGGACGGTTGCCAGAGGCTGG + Intergenic
1169649584 20:7852117-7852139 AAAGAAAAGAGGCCAGAAGCAGG + Intergenic
1169682111 20:8227112-8227134 GAAGGAATGGGTACAGAGTCTGG + Intronic
1169812809 20:9625737-9625759 GAAGGAATGAAGACAGAGCCAGG - Intronic
1169889299 20:10435195-10435217 GCAGGATTGAGGCCACAGCCAGG - Intergenic
1170062797 20:12276776-12276798 GAAGGAAGGAGGCCCAAGCCTGG + Intergenic
1170230203 20:14037922-14037944 GGCGGATTGAGGCCAGAAGCGGG + Intronic
1170572476 20:17640416-17640438 GAAGAGGTGAGGCCAGAGGCAGG + Intronic
1170673259 20:18454502-18454524 CAAGGAGTTAGGCCAGAGGATGG - Intronic
1170756634 20:19211877-19211899 GAAGAGGCGAGGCCAGAGGCTGG + Intergenic
1171024927 20:21621586-21621608 GAAGGATGGTTGCCAGAGGCTGG + Intergenic
1171059950 20:21946461-21946483 GAAGGAATAAGGTAAGAGTCAGG + Intergenic
1171370905 20:24661434-24661456 GAAGGAAGGAGGAAAGAGGGAGG + Intronic
1172055627 20:32152431-32152453 GAAGGAATGAGGCATGAGGAAGG - Intronic
1172078286 20:32316734-32316756 GCTGGAATGAGGGGAGAGGCAGG - Exonic
1172441882 20:34971679-34971701 GAAGGGGTGAGGCCGGTGGCAGG - Intergenic
1172621125 20:36319394-36319416 CAAGGACTGAGGACAGAGCCTGG + Intronic
1172627208 20:36354101-36354123 GAGAGAATGTGGCCTGAGGCGGG - Intronic
1173107268 20:40149777-40149799 GAAGGATGAGGGCCAGAGGCTGG - Intergenic
1173961652 20:47077293-47077315 GAATGAATGAATCCACAGGCTGG - Intronic
1174288817 20:49492306-49492328 GAAGGATGGTTGCCAGAGGCTGG + Intergenic
1174348442 20:49949163-49949185 GAAGAAAGGAGGCCAGACACAGG + Intronic
1174377554 20:50136425-50136447 GTATGAATGAGGACGGAGGCTGG + Intronic
1174513463 20:51073480-51073502 GAAGGAATGTGGTAAGAGACTGG + Intergenic
1174545082 20:51319080-51319102 GGAGGAATGACGGCAGAGGCGGG + Intergenic
1174681922 20:52416708-52416730 GAGGGAGGGAGGCCAGAGGAAGG + Intergenic
1175194836 20:57235910-57235932 TAGGGAGTGAGGACAGAGGCAGG + Intronic
1175194840 20:57235929-57235951 CAGGGAGTGAGGACAGAGGCAGG + Intronic
1175194844 20:57235948-57235970 CAGGGAGTGAGGACAGAGGCAGG + Intronic
1175314863 20:58040159-58040181 GAAGAAACAAGGGCAGAGGCGGG - Intergenic
1175381363 20:58566586-58566608 GATGGAATGAGGCCAGGTACAGG - Intergenic
1175400277 20:58696290-58696312 GAGGGAATGTGGGCAGAGGCTGG - Intronic
1175730725 20:61352159-61352181 GAAGAAAGGTGGCCAGAGGCTGG - Intronic
1175923743 20:62462139-62462161 GAAGGAAGGAGGCCTGAGGACGG - Intergenic
1175943225 20:62547408-62547430 GAAGGCAGGAGCCCGGAGGCGGG - Intergenic
1177208050 21:18033293-18033315 GTAGGGATAAGGACAGAGGCAGG + Intronic
1178098946 21:29245161-29245183 GAAGCAATGATGACAGAGCCAGG + Intronic
1178127743 21:29533806-29533828 GAAGTAATGAAGGGAGAGGCTGG - Intronic
1178894850 21:36549804-36549826 GTAGGAATGTGGCCAGGGGAGGG - Intronic
1179178590 21:39026501-39026523 GGAGGAAAGAGGCCAGAGGGAGG + Intergenic
1179288382 21:39997247-39997269 GAGAGAGTGAGGCCACAGGCAGG - Intergenic
1179390612 21:40986830-40986852 GAAGTAATAAGCCCAAAGGCAGG + Intergenic
1179441151 21:41395131-41395153 GAAGGAGTGGGGACAGAGGAGGG + Intronic
1179642910 21:42758926-42758948 GAGGGAAGGAAGCCAGGGGCTGG + Intronic
1181571742 22:23771719-23771741 AAAGAAAGGAGGCGAGAGGCCGG - Intronic
1181680151 22:24489797-24489819 GAAGGATGGTTGCCAGAGGCTGG + Intergenic
1181782804 22:25205302-25205324 GAAGCCATGAGCCCACAGGCTGG - Exonic
1181822920 22:25489545-25489567 GAAGCACTGAGCCCAGAGTCTGG - Intergenic
1182415320 22:30217704-30217726 GGAGGAAAGTGGCCACAGGCTGG - Intergenic
1183256275 22:36764477-36764499 GAATGAATGAGGCCAGCTGCAGG - Intronic
1183467353 22:37986432-37986454 GAAGGAAAGAGCCCAGAGTTAGG + Intronic
1183615378 22:38941926-38941948 GATGGAATGAGGAGGGAGGCTGG - Intergenic
1183675146 22:39294981-39295003 GAGGAACTGAGGCCTGAGGCAGG + Intergenic
1183809042 22:40238488-40238510 GCAGGGATGAGACCAGAAGCAGG - Intronic
1184333464 22:43840205-43840227 GGAGGGGTGAGGCCAGAGGGAGG + Intronic
1184468586 22:44683217-44683239 GCAGGGATAAGGCCAGAGGGTGG - Intronic
1184753662 22:46503543-46503565 GAAGCCAAGAGGCCCGAGGCCGG + Intronic
1185076099 22:48683520-48683542 GACGGGCTGAGGCCAGAGCCAGG + Intronic
1185077997 22:48693622-48693644 GCAGGAATAAGGCCCGGGGCAGG - Intronic
1185078011 22:48693685-48693707 GTAGGAATGAGGCCTGGAGCAGG - Intronic
1185251723 22:49805520-49805542 AACGGAAGGAAGCCAGAGGCTGG + Intronic
949438562 3:4055903-4055925 CAAGGAATGTGGCTAGAAGCTGG - Intronic
949978031 3:9478377-9478399 GAATGAATGAGGCCAAGGTCAGG - Intronic
949997080 3:9626593-9626615 GAAGGAGTGAGGTAGGAGGCAGG - Intergenic
950110131 3:10413444-10413466 GAACGAATGAACCCAGAGCCAGG + Intronic
950146964 3:10656963-10656985 AAAGAGATGAGGCCAGCGGCTGG + Intronic
950371284 3:12532957-12532979 AAAAGACTGACGCCAGAGGCAGG - Exonic
950504294 3:13384493-13384515 GAAGAAATGAGGCAGGAGGATGG + Intronic
950613793 3:14142928-14142950 CAAGAACTGAGGCCTGAGGCTGG + Exonic
950625963 3:14247022-14247044 GAATGAATGAGGGCAGAAGTAGG - Intergenic
950849879 3:16052226-16052248 GAGGAAATGAGGACAGAGCCTGG - Intergenic
951072990 3:18353599-18353621 CCAGGAGTGAGGCCAGAGGATGG + Intronic
951760569 3:26143220-26143242 GAAGGATGGTGACCAGAGGCTGG + Intergenic
952271159 3:31832928-31832950 GAAGGAGTGGGGCGAGAGCCAGG + Intronic
952341637 3:32452188-32452210 GGAGGACTGGGGCCAGTGGCTGG + Intronic
953706911 3:45238046-45238068 GAAGGAATAAGGCTAATGGCAGG + Intergenic
953767166 3:45752439-45752461 AGAGGAACGAGGCCAGAGGCAGG - Intergenic
953772309 3:45787202-45787224 GATGGAGAGAGGCCAGCGGCAGG - Intronic
953990137 3:47477118-47477140 CAAGGAGGGAGGCCAGAGTCCGG - Intronic
954522295 3:51239490-51239512 AAAGAAATGAGGCCAGTGGCTGG - Intronic
954784323 3:53081836-53081858 GATGGGATGAAGACAGAGGCAGG + Intronic
954793021 3:53146744-53146766 CAAGGATTGAGGCCAGGGTCAGG - Intergenic
954869564 3:53757505-53757527 GAAGGGCTGAGGCCAGAGGCAGG - Intronic
955020367 3:55114952-55114974 GAAGGAATGAGGCATGAGGTGGG + Intergenic
955808168 3:62758345-62758367 GGAGGAAAGAGGCCAAAGACTGG + Intronic
957972239 3:87397106-87397128 AATGGAATGAGGGAAGAGGCAGG - Intergenic
959393176 3:105802192-105802214 TAAGGAAAGAGGCTAGGGGCAGG - Intronic
960022051 3:112965885-112965907 GAAGGAATGAGACAAAAAGCAGG + Intronic
960662203 3:120072816-120072838 GAAATAATAAGGACAGAGGCAGG + Intronic
961037341 3:123651768-123651790 TCATGAGTGAGGCCAGAGGCTGG - Intronic
961218217 3:125178143-125178165 GTAGAAATGGGGCCTGAGGCAGG - Intronic
961457426 3:127031167-127031189 TAAGGAGTGAGGCCAAGGGCTGG - Intronic
961544532 3:127623185-127623207 CAAGGATTGAGGCCAGAGTCAGG + Intergenic
961551938 3:127674364-127674386 GCAGGAAGGAGGTCAGAGCCTGG - Intronic
961552047 3:127674988-127675010 GAAGGAATGAGGCCAGTGGGAGG - Intronic
961665815 3:128492678-128492700 GAAGACAAGAGGCCCGAGGCGGG + Intronic
962478667 3:135779870-135779892 GGAGCAATGAGACCAGGGGCAGG - Intergenic
962484464 3:135828976-135828998 GAAGGAAAGTTACCAGAGGCTGG + Intergenic
963129815 3:141847724-141847746 AAAGGAGTTAGGCCAGAGGTTGG + Intergenic
963179232 3:142336540-142336562 GAGGGAATGAGATCAGAGACAGG + Intronic
963861357 3:150313694-150313716 GAAGGGGTGAGGTTAGAGGCAGG + Intergenic
964759604 3:160122292-160122314 GAAGGATTGTTACCAGAGGCTGG + Intergenic
964785408 3:160390830-160390852 GTAGAAATGAGGTAAGAGGCAGG + Intronic
965433407 3:168617306-168617328 TAAGGAATGAAGCCTGAGGCAGG + Intergenic
967283197 3:187842478-187842500 GAACAATAGAGGCCAGAGGCTGG - Intergenic
968385965 4:138297-138319 GAAGGATTGTTACCAGAGGCTGG - Intronic
968472120 4:787000-787022 GAAGGCAGGATGCCAGGGGCTGG - Intronic
969235881 4:5864879-5864901 CAAGGAATGAAGCCAGAGGAGGG + Intronic
969324557 4:6433697-6433719 GAAAGAATGAGGACAGAACCTGG - Intronic
969564518 4:7970275-7970297 GCAGGAATGTGGCCACAGGGAGG - Intronic
970254587 4:14154338-14154360 GAAGGACTGAGTACAGAAGCAGG - Intergenic
970641622 4:18072726-18072748 GAAGGATGGTTGCCAGAGGCTGG - Intergenic
972148600 4:36061368-36061390 GAAGGATGGCAGCCAGAGGCTGG - Intronic
974074229 4:57154432-57154454 GAAGGAATGTAGCTATAGGCGGG - Intergenic
974639980 4:64616440-64616462 GAAGAAATGAGGAAGGAGGCAGG - Intergenic
975688622 4:76943947-76943969 GAAGGAGTGATGCCAGAGCCAGG + Intergenic
977888984 4:102284916-102284938 GAAAGCATAAGACCAGAGGCCGG + Intronic
977979853 4:103308347-103308369 TGAGAAATGAGGCAAGAGGCAGG - Intergenic
978860905 4:113447857-113447879 AAAGGCAAGAGGCAAGAGGCTGG - Intergenic
981630669 4:146814983-146815005 GAAGCAATGAGGTCAGAGATAGG + Intronic
982329652 4:154166808-154166830 GAAGGAATGAGGGGAAAGGAGGG + Intergenic
984072262 4:175129694-175129716 GAAGGAATAAGCACAGAGGAAGG + Intergenic
984227257 4:177050371-177050393 CAAGTAATGGGGCCAGAGACAGG - Intergenic
984328045 4:178278128-178278150 AAAGAAATGAGGCAAGTGGCTGG - Intergenic
985812579 5:2100798-2100820 GAAGAATTGTGGGCAGAGGCTGG + Intergenic
986171195 5:5316173-5316195 GAAGGCATCAGGCCTGGGGCTGG - Intronic
986405923 5:7424915-7424937 GGAGGAATGAGGCCAAGGACAGG - Intronic
986667757 5:10118025-10118047 GAAAGAGTGAGCCCAGGGGCAGG - Intergenic
987025940 5:13926395-13926417 GACTGTGTGAGGCCAGAGGCAGG - Intronic
987451306 5:18087449-18087471 GAAGCAATGAGGCCAAAGGGAGG + Intergenic
987452919 5:18108156-18108178 GATGGAATGAGCTCAGAGCCTGG - Intergenic
987650177 5:20730999-20731021 GGAGGAATGTGGCCAGAGAGAGG + Intergenic
987682774 5:21159442-21159464 GAAGGGATGAATCCAGAGGTTGG + Intergenic
988444234 5:31267379-31267401 GAAGGAAGGAGGAATGAGGCTGG + Exonic
988615104 5:32767929-32767951 GAAGTAATGAGGCCAGAAATTGG + Intronic
988745382 5:34130468-34130490 GGAGGAATGTGGCCAGAGAGAGG - Intergenic
989108206 5:37883144-37883166 GAAGGAAGGAGGACTGAGGAAGG + Intergenic
989167822 5:38448055-38448077 GCAGCGCTGAGGCCAGAGGCAGG + Intronic
989645793 5:43631219-43631241 GTAGGAATGAGGCCTGTGGTTGG + Intronic
990341751 5:54830311-54830333 GGAGGAATGAAGCCTGGGGCTGG - Intergenic
990449123 5:55918864-55918886 GAATGAGGGAGGCCCGAGGCAGG + Intronic
990763066 5:59151898-59151920 GAAGGAGTGAGGGAAGAGACTGG + Intronic
990986996 5:61649801-61649823 GAAGCTATGAGGGCAGAGGCTGG + Intronic
992946053 5:81811521-81811543 GAAGTAATCAGGCCGGGGGCAGG - Intergenic
993333642 5:86630571-86630593 GGAGGAATGGGGTCAGCGGCTGG + Intergenic
993510930 5:88770842-88770864 GAGGAAATGAGCCTAGAGGCAGG - Intronic
994888993 5:105605151-105605173 GAAGGAATTAGGCCTGGGGTGGG + Intergenic
995230104 5:109751159-109751181 GAAGGACAGACACCAGAGGCTGG - Intronic
996082298 5:119269203-119269225 GAAGGAATGAGGCTCACGGCAGG - Intronic
996713202 5:126563994-126564016 CTAGGAATGAGACCAGAGCCTGG - Intronic
997230243 5:132237282-132237304 GCAGGAAAGAGGCCACAGGAGGG - Intronic
997230320 5:132237944-132237966 TAAGTAATAAGGCCAGAGCCTGG - Intronic
997662948 5:135603517-135603539 AGAGGGATGAGGCCAGAGGCAGG - Intergenic
998161335 5:139814501-139814523 CCAGGAATGAGGACAGTGGCGGG - Intronic
999264605 5:150258137-150258159 GGAGCATGGAGGCCAGAGGCAGG + Intronic
999286440 5:150396914-150396936 GGAGGAATGAGACCAGGTGCTGG - Intronic
999632546 5:153585603-153585625 TAAGAAATGAGGACAGGGGCCGG - Intronic
1000105912 5:158058557-158058579 GAAGGCATGAGGCCTAAGACAGG + Intergenic
1000205163 5:159051386-159051408 GAGGGAATGCGGCCCGAGGCGGG - Intronic
1000350422 5:160348392-160348414 GGAGGCATGAGGCGTGAGGCTGG - Exonic
1000697293 5:164403361-164403383 GACAGAATTAGGCCAGAGCCAGG - Intergenic
1001117878 5:168954957-168954979 CAAGGAATGAGGCCGGAACCTGG - Intronic
1001520236 5:172386104-172386126 GAAGTGACGAGGCCAGAGTCAGG - Intronic
1002342866 5:178528123-178528145 GGTGGCAGGAGGCCAGAGGCGGG - Intronic
1002776591 6:333172-333194 GGAGAAATGAGGACAGAGACAGG + Intronic
1005001580 6:21247154-21247176 GAACGAAAGAGGTCAGGGGCTGG - Intergenic
1005310689 6:24556188-24556210 GAAGGAAGGAGGGGAGAGGAGGG - Intronic
1005543498 6:26838220-26838242 GGAGGAATGTGGCCAGAGAGAGG - Intergenic
1005958991 6:30683341-30683363 GAAGAAGTGAGGCCAGGGCCAGG + Intronic
1005981728 6:30841826-30841848 GAAGGGCTGTGGGCAGAGGCCGG - Intergenic
1005993976 6:30920767-30920789 GAAGGACTGGGGCCAGGGGTTGG + Intronic
1006425929 6:33962992-33963014 GGAGAAATGAGGCCTGAGGAGGG - Intergenic
1006669737 6:35722566-35722588 GGGGAGATGAGGCCAGAGGCAGG - Intronic
1006793497 6:36718175-36718197 TAAGGAATGGGGCCAGTGACTGG + Intronic
1007258566 6:40545757-40545779 GGAGGAATGAAGCCAGGGCCTGG + Intronic
1007388796 6:41537815-41537837 GAAGGAATGAGATGAGAGACAGG - Intergenic
1007503157 6:42313961-42313983 AAAGGAATGAGACCGGAAGCCGG + Intronic
1007748700 6:44058875-44058897 GAGGGGAAGAGGCCAGACGCTGG - Intergenic
1008679250 6:53855130-53855152 GAAAGAATGTGGGCAGAGGCAGG + Intronic
1009014328 6:57880389-57880411 GGAGGAATGTGGCCAGAGAGAGG - Intergenic
1010342369 6:74769340-74769362 GTAGGAGTGAGGGCAGAGGGTGG + Intergenic
1010837002 6:80600728-80600750 GAAGGATTGTTACCAGAGGCTGG - Intergenic
1011697109 6:89922429-89922451 CGGGGAATGAGGTCAGAGGCAGG - Intergenic
1011912754 6:92463423-92463445 GAAGGAAGCAGCCCAGTGGCTGG - Intergenic
1013111382 6:107067878-107067900 GAAGGAATGGGGGCAGCGGAAGG + Exonic
1013587161 6:111589690-111589712 TCAGGAATGAGGGCAGGGGCTGG - Intronic
1013655448 6:112242073-112242095 GAAGGAAGTAGAGCAGAGGCAGG - Intronic
1014327181 6:120013075-120013097 GAAGGATGGTTGCCAGAGGCTGG - Intergenic
1015116825 6:129659236-129659258 GAATGAATGAGGCAGTAGGCAGG + Intronic
1015745636 6:136506691-136506713 AAAGGAATGAAGCTTGAGGCGGG + Intronic
1016013779 6:139164161-139164183 GAAGTAAGGAGGCCAGAGGGAGG - Intronic
1016968484 6:149740938-149740960 AAAGGGAATAGGCCAGAGGCAGG - Intronic
1017192635 6:151670075-151670097 TAAAGAAACAGGCCAGAGGCTGG - Intronic
1017400053 6:154050579-154050601 GAAGGATGGTGACCAGAGGCTGG + Intronic
1018006759 6:159629564-159629586 GAAGGAAGGAAGCTGGAGGCAGG - Intergenic
1018424068 6:163664170-163664192 GAGGGGATGAGGCCTAAGGCTGG - Intergenic
1018907649 6:168084819-168084841 GGAGGAATGAGGTGGGAGGCGGG - Intergenic
1018978581 6:168583863-168583885 GAAGGGAGGAGGGCAGAGGAGGG + Intronic
1019142626 6:169957732-169957754 GAAGGAAGGAGGCCTCAGGCAGG - Intergenic
1019275074 7:171851-171873 GAAGACAGGAAGCCAGAGGCAGG - Intergenic
1019794275 7:3038352-3038374 TAAGGAATGAGGCCAGTCCCAGG + Intronic
1019895356 7:3978048-3978070 AAAGGAAGGAGGAAAGAGGCAGG - Intronic
1020017878 7:4842069-4842091 GATGCAACAAGGCCAGAGGCTGG + Intronic
1020206402 7:6120537-6120559 GAAAGGCTGAGGCAAGAGGCTGG - Intronic
1020256309 7:6504547-6504569 GAGGGAATGAGGCTGGAGGCGGG + Intronic
1021759751 7:23892164-23892186 GAAGGAAGGAGGGGAGAGGAGGG + Intergenic
1021934962 7:25621209-25621231 GAAGGAATGAGGCCAGAAGGAGG - Intergenic
1022477918 7:30723801-30723823 GAGGCAATGAGGGCAGGGGCTGG + Intronic
1022541490 7:31139821-31139843 GAAGGAAGGTTACCAGAGGCTGG - Intergenic
1022657850 7:32337121-32337143 GAAGGGAGGAGACCAGAGGTAGG - Intergenic
1022972594 7:35531193-35531215 GAAGGATGGTGACCAGAGGCTGG + Intergenic
1023410539 7:39885379-39885401 GAATGAATGAGGGAAGAGGGAGG + Intergenic
1023837014 7:44074281-44074303 GAAGGGATGTGGCCTGGGGCTGG - Intronic
1024758858 7:52569497-52569519 AAAGGGAAGAGGCCACAGGCAGG - Intergenic
1024921298 7:54557628-54557650 TAAGGAATGAGGAAACAGGCCGG - Intronic
1027715918 7:81669561-81669583 GAAGGCTGGAGTCCAGAGGCTGG + Intergenic
1029161485 7:98555598-98555620 GAATGAGTGAGGCCAGTGGCGGG - Intergenic
1029436469 7:100566711-100566733 GACAGAAGGAGGGCAGAGGCTGG - Exonic
1029445819 7:100612434-100612456 GAAGGGGCGAGGCCAGCGGCGGG + Intronic
1029705047 7:102271648-102271670 GAGGGGATGAGGGAAGAGGCAGG - Intronic
1030581121 7:111357129-111357151 GAAGGAATGTGGACACAGACTGG + Intronic
1031079961 7:117248852-117248874 GAAGGAATGAGGGGTGAAGCAGG - Intergenic
1031141331 7:117946741-117946763 GAAGGAATGAAAGCAAAGGCAGG - Intergenic
1031586189 7:123534639-123534661 GAAGGAGAGGAGCCAGAGGCGGG + Intronic
1032169168 7:129569984-129570006 GAAGGTTTGAGCCCAGAGGGTGG + Intergenic
1032416367 7:131738287-131738309 GGAGGAGTGAGGGCAGACGCAGG + Intergenic
1032532530 7:132634098-132634120 TAAGGAATGAGGCTCCAGGCTGG - Intronic
1032722600 7:134562979-134563001 GAAGGAATGAGGGAAGAGTAAGG - Intronic
1033886109 7:145948057-145948079 GAATGATAGATGCCAGAGGCTGG + Intergenic
1034501445 7:151453384-151453406 GAAGGAATGAGGCTCTAGCCCGG - Intergenic
1034944899 7:155255489-155255511 GGAGGAATCAGTCCAGAGGCTGG + Intergenic
1035048167 7:155982724-155982746 GAAGAAAAGAGGCCTGGGGCTGG + Intergenic
1035195939 7:157220557-157220579 GAAGGTATGAGGTCAGAGAGAGG + Intronic
1035702693 8:1648716-1648738 GGAGGAAAGAGGCCGGAAGCTGG - Intronic
1036652951 8:10657199-10657221 GTAGGACTGAGACCACAGGCTGG + Intronic
1037502734 8:19500951-19500973 AAAGGCATAAGGGCAGAGGCCGG + Intronic
1037607567 8:20450343-20450365 GGAGGAGTGAGGCAAAAGGCTGG + Intergenic
1037994711 8:23343703-23343725 GAAGGAATGCTGCCAGGGGCAGG + Intronic
1038164344 8:25070573-25070595 GAAGGAAGGTTACCAGAGGCTGG + Intergenic
1038402758 8:27297996-27298018 GAAAGCATGAGGCCCTAGGCAGG + Intronic
1038494140 8:27989898-27989920 CAAGGAGTGAAGCCAGAGGGAGG - Intronic
1038530957 8:28317642-28317664 GGAGGAGTGAGGCCAGAGGAGGG + Intronic
1040378507 8:46849752-46849774 CAAGGAATCAGGGCACAGGCAGG - Intergenic
1041061686 8:54040978-54041000 GATGGTTTGAGGCCAGAGCCAGG + Intergenic
1041230719 8:55748416-55748438 GAAGGAATGAAGGCTGAGGTGGG - Intronic
1041732955 8:61081257-61081279 GAAGGAATGAGGGCCTGGGCTGG + Intronic
1041775176 8:61515140-61515162 GAAGCACTGAGGCATGAGGCTGG + Intronic
1043384932 8:79739008-79739030 GAAGGAAGGTTACCAGAGGCAGG - Intergenic
1043507817 8:80920070-80920092 TTAGGAATGAGGTCAGAGACTGG + Intergenic
1044805589 8:96005269-96005291 GAAGGAATGACTCCAGTGGAGGG - Intergenic
1046486939 8:114899136-114899158 GAGAGAAAGAGGCCAGAGACTGG - Intergenic
1047194410 8:122708379-122708401 GGAGGAATGAGACTGGAGGCAGG + Intergenic
1048070577 8:131016733-131016755 GAAGGTGTAGGGCCAGAGGCAGG + Intronic
1048079727 8:131112301-131112323 GAAGGATGGTTGCCAGAGGCTGG - Intergenic
1049222196 8:141433239-141433261 GGAGGGATGAGTCCAGAGGCAGG - Intergenic
1049288148 8:141787690-141787712 GACGGCATGGAGCCAGAGGCTGG + Intergenic
1049440835 8:142608867-142608889 CAAGGAAAGAGGCCGGAGGCTGG - Intergenic
1049512951 8:143038932-143038954 GAAGCAGGGAGGGCAGAGGCTGG + Intergenic
1049652011 8:143774255-143774277 GAAGAAAAGAAGCCACAGGCAGG + Intergenic
1049658548 8:143809518-143809540 GCAGGAAGGAGGCAGGAGGCTGG - Intronic
1050576154 9:6997694-6997716 GGAGGAAAGAGGCCAGAGAGAGG - Intronic
1051123805 9:13780926-13780948 GAAGGATTGTTACCAGAGGCTGG - Intergenic
1051996533 9:23224341-23224363 AAAGAAATGAAGGCAGAGGCTGG + Intergenic
1053105808 9:35406678-35406700 GTAGGGGTGTGGCCAGAGGCGGG + Intergenic
1054738116 9:68776822-68776844 AAATGAATAATGCCAGAGGCAGG - Intronic
1055557379 9:77489183-77489205 GAATGAATGAGCCCAAAGACAGG + Intronic
1056180523 9:84078171-84078193 GAAGGATGGTGACCAGAGGCTGG + Intergenic
1056212253 9:84375742-84375764 GAAGGGATGAGGCCAGGGAGGGG + Intergenic
1056751051 9:89351549-89351571 AAAGGAATGAGGCCAGGGAGGGG - Intronic
1056918379 9:90763942-90763964 CAGGGAATGAGGTAAGAGGCAGG - Intergenic
1057271271 9:93652994-93653016 GACGGAATGAGCCCAGGCGCTGG - Intronic
1057533324 9:95874690-95874712 CAAGGAATGTGGACAGAAGCTGG + Intergenic
1057766245 9:97922029-97922051 GTAGGAATGAGGACAGAGAAGGG - Intronic
1058482770 9:105413852-105413874 GAAGGAATGTGTGTAGAGGCTGG + Intronic
1058622421 9:106897806-106897828 GAGGGAAAGAGGCCAGCAGCAGG + Intronic
1058797909 9:108516234-108516256 AAAGGAAAGAGGGAAGAGGCAGG + Intergenic
1058882215 9:109295551-109295573 GAAAAAGTGAGGCAAGAGGCAGG + Intronic
1059534778 9:115070446-115070468 GCAGGACTGAGGTCAGAGGATGG + Intronic
1059972873 9:119685634-119685656 GAATGAATGTGGCCACAGCCTGG + Intergenic
1060791171 9:126486696-126486718 GGAGGAATGAGGCCTGGGGTAGG - Intronic
1060795120 9:126507940-126507962 GATGGAATGAGGACCCAGGCAGG + Intergenic
1060801372 9:126547781-126547803 GGAGGGATGAGGGCAGAGGAGGG - Intergenic
1061265194 9:129500707-129500729 GAGGGAATGGGGCCAGCGCCTGG - Intergenic
1061267699 9:129516860-129516882 AAAGGAAAGAAGACAGAGGCTGG + Intergenic
1061277160 9:129575834-129575856 GAAGGAAGGAGGCGGGTGGCTGG - Intergenic
1061553450 9:131351004-131351026 GAAAGAGTGTGGTCAGAGGCTGG + Intergenic
1061791433 9:133061285-133061307 GAGGGAAAGAGGCCAGTGGGAGG - Intergenic
1061989706 9:134152358-134152380 CAAGGAATGATCCAAGAGGCTGG - Intronic
1062211468 9:135366568-135366590 GAAGGAAAGAAGCCAGAGGGTGG + Intergenic
1062216393 9:135392014-135392036 GGAGGCAGGATGCCAGAGGCTGG - Intergenic
1185789317 X:2916705-2916727 GAATGATAGAGACCAGAGGCTGG + Intronic
1186834814 X:13427287-13427309 AAAGGAATGAGGCAATAGGGTGG - Intergenic
1187806269 X:23124725-23124747 GAAGGTTTGAGGGCAGGGGCAGG - Intergenic
1188094675 X:26006529-26006551 GAAGGATGGTTGCCAGAGGCTGG + Intergenic
1189087431 X:38040488-38040510 GAAGGATGGTTGCCAGAGGCTGG - Intronic
1190245542 X:48688270-48688292 GGAGGAAAAAGGCCAGGGGCAGG - Intronic
1190276506 X:48902832-48902854 GGAGGAAGGAGGCCGGAGGATGG - Intronic
1190289717 X:48984208-48984230 GAAGGAAGGAGGAAAGGGGCAGG - Intronic
1190335650 X:49260170-49260192 GAATGAATGAAGCCAGAGATGGG + Intronic
1190364742 X:49681030-49681052 GAATGATTGTTGCCAGAGGCTGG - Intergenic
1190524602 X:51315917-51315939 GGAGGAATGATTCCAGAAGCAGG - Intergenic
1190638838 X:52463493-52463515 GAAGGAATGAAGGAAGAGGCAGG - Intergenic
1191766038 X:64699191-64699213 GAAGGATTGTTACCAGAGGCTGG - Intergenic
1191852455 X:65595546-65595568 AAAGAACTGAGGCCAGAGGGGGG - Intronic
1192029871 X:67498441-67498463 GAAGGATGGTTGCCAGAGGCTGG + Intergenic
1192332432 X:70187127-70187149 GTAGCAATGGGGACAGAGGCAGG + Intronic
1192980431 X:76334122-76334144 GAAGGATTGTTACCAGAGGCTGG + Intergenic
1193671437 X:84391128-84391150 GAATGACAGATGCCAGAGGCTGG - Intronic
1194512844 X:94816511-94816533 GAAGGAATGAAAGGAGAGGCCGG - Intergenic
1194624124 X:96208782-96208804 GAAGGATTGTTACCAGAGGCTGG + Intergenic
1195399469 X:104446274-104446296 GAAGGAAAGAGGGCAGAGGATGG + Intergenic
1195472651 X:105249322-105249344 GAAGGATTGTTACCAGAGGCTGG + Intronic
1196577472 X:117336503-117336525 GAAGGATAGATGCCAAAGGCTGG - Intergenic
1197410850 X:126114640-126114662 AAAGGAATTATGCCACAGGCAGG + Intergenic
1198366187 X:135942156-135942178 GAATGAAAGAGGCAAGATGCGGG + Intergenic
1199246780 X:145614215-145614237 GCAGGAATGAGGCAAGAAGCAGG - Intergenic
1200734432 Y:6779056-6779078 GACAGAAAGAGGCCAGAGACTGG + Intergenic
1200855739 Y:7936291-7936313 GAAGGAATGTGGCCACAGCTGGG - Intergenic
1201285672 Y:12376572-12376594 GAATGATAGAGACCAGAGGCTGG - Intergenic
1201671872 Y:16531087-16531109 GAAGGAAGGTTACCAGAGGCTGG + Intergenic
1202041211 Y:20685989-20686011 GAGGGAATGAGGCAAGAGGCAGG + Intergenic