ID: 1063299712

View in Genome Browser
Species Human (GRCh38)
Location 10:4840593-4840615
Sequence ATGGGAAGGAATGAGGCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 551
Summary {0: 1, 1: 0, 2: 5, 3: 45, 4: 500}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063299712_1063299723 21 Left 1063299712 10:4840593-4840615 CCTCTGGCCTCATTCCTTCCCAT 0: 1
1: 0
2: 5
3: 45
4: 500
Right 1063299723 10:4840637-4840659 CAGCCACATGAAGCTGCTGTGGG No data
1063299712_1063299715 -6 Left 1063299712 10:4840593-4840615 CCTCTGGCCTCATTCCTTCCCAT 0: 1
1: 0
2: 5
3: 45
4: 500
Right 1063299715 10:4840610-4840632 TCCCATCCCTGTGAACATCCTGG No data
1063299712_1063299726 29 Left 1063299712 10:4840593-4840615 CCTCTGGCCTCATTCCTTCCCAT 0: 1
1: 0
2: 5
3: 45
4: 500
Right 1063299726 10:4840645-4840667 TGAAGCTGCTGTGGGGTCCTTGG No data
1063299712_1063299722 20 Left 1063299712 10:4840593-4840615 CCTCTGGCCTCATTCCTTCCCAT 0: 1
1: 0
2: 5
3: 45
4: 500
Right 1063299722 10:4840636-4840658 TCAGCCACATGAAGCTGCTGTGG No data
1063299712_1063299724 22 Left 1063299712 10:4840593-4840615 CCTCTGGCCTCATTCCTTCCCAT 0: 1
1: 0
2: 5
3: 45
4: 500
Right 1063299724 10:4840638-4840660 AGCCACATGAAGCTGCTGTGGGG No data
1063299712_1063299717 -5 Left 1063299712 10:4840593-4840615 CCTCTGGCCTCATTCCTTCCCAT 0: 1
1: 0
2: 5
3: 45
4: 500
Right 1063299717 10:4840611-4840633 CCCATCCCTGTGAACATCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063299712 Original CRISPR ATGGGAAGGAATGAGGCCAG AGG (reversed) Intronic
900518951 1:3096418-3096440 AGGGGAAGGAATGAGGTCATGGG + Intronic
900926665 1:5710323-5710345 ACTGGAAAGAAGGAGGCCAGTGG + Intergenic
901202706 1:7475732-7475754 CTGGGAAGGAAACAGGGCAGGGG + Intronic
902195578 1:14795723-14795745 CTGGTGTGGAATGAGGCCAGAGG - Intronic
902754666 1:18541130-18541152 ATTGGATGGGATGAGGCCAGAGG - Intergenic
903178825 1:21595364-21595386 ATGGGCAGGGATGAGGCCAGAGG - Intergenic
903456700 1:23492415-23492437 GTGAGAAGGGATGAGGTCAGAGG - Intergenic
904213301 1:28899792-28899814 AGGGGATGGATTGAGGTCAGAGG + Intronic
906128624 1:43442700-43442722 ATGGGACAGACTGAGGGCAGAGG + Intronic
906132300 1:43467980-43468002 AGTGGGAGGAATGAGCCCAGTGG - Intergenic
906315436 1:44784155-44784177 ACGGGAGGGAAGGAGGGCAGTGG + Exonic
906511195 1:46411289-46411311 AAGGGAAGGAGTGAGTCCATGGG - Intronic
906916369 1:50015140-50015162 ATGAGAAGGAATTAGCCCAGTGG - Intronic
906943567 1:50276450-50276472 GCAGGAAGGAATAAGGCCAGGGG + Intergenic
906986901 1:50692433-50692455 ACGGGTAGGAATGAGGAAAGCGG - Intronic
907108573 1:51906135-51906157 ATGGGTAGGAATGTGGGGAGGGG - Intergenic
907974602 1:59419271-59419293 ATTGGAGGAAATGAGGCTAGAGG + Intronic
908458542 1:64327398-64327420 ATGGTAAGGAAAGGGGCCACAGG - Intergenic
909482646 1:76142149-76142171 ATGGGAGGGAATGCGGAGAGGGG + Intronic
911670084 1:100598061-100598083 ATGAGAAGGAAAGAGGCAAGAGG + Intergenic
911804338 1:102186465-102186487 CTGGGAAGGCATGAAGACAGAGG + Intergenic
912957680 1:114166971-114166993 ATGGGAGGGAGTGAGGCCACTGG - Intergenic
914263484 1:146019108-146019130 ATGGGGAGGAATGGTGCCCGTGG + Intronic
914587186 1:149073298-149073320 ATGTACAGAAATGAGGCCAGGGG + Intronic
914587963 1:149079587-149079609 ATGTACAGAAATGAGGCCAGGGG + Intronic
914880760 1:151544921-151544943 ATGGGAAGGAAGCATGTCAGGGG - Intronic
915184963 1:154097935-154097957 AGTGGATGGAATGAGCCCAGTGG - Intronic
915674009 1:157514339-157514361 ATGGGAAAGTGTGAGGCCTGAGG + Exonic
915994345 1:160548559-160548581 ATGGGAGGGAATGGGGGCGGGGG + Intronic
917969342 1:180197091-180197113 AGGGGAGGGAATGGGGTCAGGGG - Exonic
918364451 1:183792077-183792099 ATGGGAAGGTATGAGGCTTTTGG - Intronic
920455535 1:206098299-206098321 GTGGGAAGGAATTTGGCCGGTGG - Intronic
921292215 1:213669328-213669350 ATAGGGAGGACTGAGGCGAGGGG + Intergenic
921368362 1:214396501-214396523 ATTTGAAGGAATGAGGCCAGAGG - Intronic
922412654 1:225391249-225391271 ATAGGAAGGAAGAAGGGCAGGGG + Intronic
922644565 1:227273632-227273654 AAGGAAAAGAATGATGCCAGTGG + Intronic
923278025 1:232415456-232415478 AGGGTAAGGGGTGAGGCCAGAGG + Intronic
924009692 1:239651541-239651563 AGGGGAAGAAGTGAGGACAGAGG - Intronic
924012407 1:239680041-239680063 AAGGGAAGGTATTAGGGCAGTGG - Intronic
924215862 1:241821836-241821858 ATGGTAAGGAATACTGCCAGTGG + Intergenic
924579277 1:245309481-245309503 TTGGGATGGAATGACGCCATCGG + Intronic
1063129537 10:3166135-3166157 CTGAGAAGGAATGAGGGGAGTGG - Intronic
1063233172 10:4086182-4086204 AAGGGAGGGTCTGAGGCCAGAGG + Intergenic
1063299712 10:4840593-4840615 ATGGGAAGGAATGAGGCCAGAGG - Intronic
1063543230 10:6955495-6955517 GTGGGAAGGGATGTGGGCAGTGG + Intergenic
1063811125 10:9709018-9709040 ATGAAAAGAAATGAGGACAGAGG + Intergenic
1064250573 10:13703487-13703509 ATGGGAATGATTCAGGGCAGAGG - Intronic
1065488369 10:26255914-26255936 ATGGGGAGGAAGGAGGGGAGGGG + Intronic
1066055053 10:31673174-31673196 AGGAGCAGGCATGAGGCCAGGGG + Intergenic
1066229600 10:33419541-33419563 GTGGGAATGAGTGTGGCCAGAGG + Intergenic
1067472002 10:46544248-46544270 ATGGACAGGAAAGAGGCCAAGGG + Intergenic
1068141391 10:53012452-53012474 ATTGGAAGGAATGAAGACAAAGG - Intergenic
1068199783 10:53768085-53768107 ATGGGAAGTGATTAGACCAGGGG - Intergenic
1069059788 10:63883470-63883492 AGATGAAGAAATGAGGCCAGGGG + Intergenic
1069204652 10:65666729-65666751 ATGGGAATGGAAGTGGCCAGAGG - Intergenic
1069916887 10:71792161-71792183 AAAGGAAGCAATGAGGCCAATGG + Intronic
1070130766 10:73653881-73653903 ATGAGGAGGAAACAGGCCAGGGG + Intronic
1070167051 10:73906805-73906827 ATGGAAAGCAAAGAGCCCAGGGG - Intergenic
1071949847 10:90690508-90690530 ATGCGCAGGAATGATTCCAGAGG - Intergenic
1072327790 10:94315238-94315260 ATGTGATGGACTGAGGGCAGTGG - Intronic
1072944012 10:99793451-99793473 ATGGGAAGAAAGGAGGGCTGAGG - Intronic
1073061646 10:100737080-100737102 AAGGGAAAGAAGGAGGGCAGGGG - Intronic
1073291316 10:102414661-102414683 GTGGGGAGCAAAGAGGCCAGGGG - Intronic
1073395119 10:103211154-103211176 AAGGGAAGAAATGATGGCAGTGG - Intergenic
1073641078 10:105253107-105253129 ATTGGAATGAATAATGCCAGGGG - Intronic
1073811989 10:107162454-107162476 AAGGTAAGGAATGAGGGCAAGGG + Intronic
1075877943 10:125823271-125823293 AGGCCACGGAATGAGGCCAGAGG + Intergenic
1076076008 10:127534398-127534420 GAAGGAAGGAAGGAGGCCAGTGG + Intergenic
1076839799 10:133040447-133040469 GTGGGATGCAGTGAGGCCAGAGG + Intergenic
1076852519 10:133100006-133100028 CTGGGAAGGAAGGAAGCCCGTGG - Intronic
1076990073 11:268165-268187 ATGAGAAGGGCTGAGGCAAGAGG - Intergenic
1077164877 11:1130527-1130549 ATGAGAGGGAGAGAGGCCAGGGG + Intergenic
1077243614 11:1524984-1525006 AGGGGAAGGAAGGTGGCCACAGG + Intergenic
1078023495 11:7673637-7673659 GCCGGAAGGAAAGAGGCCAGAGG - Intronic
1078133933 11:8636877-8636899 ATGGGATGGATTGAAACCAGAGG - Intronic
1078360037 11:10660971-10660993 ATTGGAAGGGACCAGGCCAGAGG - Intronic
1078396700 11:10987770-10987792 ATGACATGAAATGAGGCCAGAGG - Intergenic
1078493150 11:11788055-11788077 ATCTGAAGGATGGAGGCCAGGGG - Intergenic
1078540174 11:12206839-12206861 AAAGGAAGGAAGGAAGCCAGAGG - Intronic
1078849581 11:15151575-15151597 ATGGAAAGATAGGAGGCCAGAGG - Intronic
1079094093 11:17499945-17499967 CTGGGAAGGTAAGAGGCCTGGGG + Intronic
1079361870 11:19776883-19776905 ATGGGTAGGGGTGAGGCCGGGGG - Intronic
1079566190 11:21886141-21886163 AGAGGAAGGAATGAGGTTAGTGG + Intergenic
1079737790 11:24018989-24019011 CTGGGAAGGAGTGTGGCAAGTGG - Intergenic
1080136658 11:28862977-28862999 ATGGCAAGGAATCAGGGCCGGGG - Intergenic
1080415413 11:32065592-32065614 ATGGGAAACACTGAGGTCAGGGG + Intronic
1082220546 11:49630234-49630256 ATGGGAAGGAATGAAAGCATAGG + Intergenic
1082419240 11:52496910-52496932 TTGGGAGGGATTGAGGCCTGTGG + Intergenic
1082812967 11:57489748-57489770 ATGGGAAGGAAGGTGGGAAGTGG + Intronic
1083106729 11:60365459-60365481 AGGGGCAGGAATGAGGAGAGAGG - Intronic
1083303508 11:61751190-61751212 AGGGGAAGAGCTGAGGCCAGTGG + Intergenic
1083842273 11:65311279-65311301 ATGGGCAGGAATGATGCCTGTGG + Intergenic
1083996732 11:66276662-66276684 AGGGCGAGGAATGTGGCCAGGGG + Exonic
1084119882 11:67062764-67062786 ATGGGAAGGGAAGAGGATAGGGG + Intronic
1086207297 11:84274885-84274907 AAGGGCAGGAATGAAGGCAGAGG - Intronic
1086629121 11:88994922-88994944 ATGGGAAGGAATGAAAGCATAGG - Intronic
1089696443 11:120218893-120218915 ATGGGAAGGCAGGGTGCCAGAGG + Intronic
1090248996 11:125238004-125238026 AGGGGAAGGAAGGAGAGCAGGGG - Intronic
1090637002 11:128695337-128695359 AGGGGAATGAATGGGACCAGGGG + Intronic
1092048998 12:5454756-5454778 ATGGAAAGCAAGGAGGACAGCGG + Intronic
1092488025 12:8919646-8919668 ATGGGAAGGACAGAAACCAGAGG - Intronic
1093369431 12:18349259-18349281 CTGGGAAGAAACCAGGCCAGAGG + Intronic
1094022472 12:25928842-25928864 ATTGGAAGGATTGGGGCAAGGGG + Intergenic
1094383953 12:29873400-29873422 AGGGGAAGACAGGAGGCCAGGGG + Intergenic
1094399389 12:30045108-30045130 ATGGGAAGCTTAGAGGCCAGTGG - Intergenic
1094417227 12:30230206-30230228 TTGGAAAGTCATGAGGCCAGAGG - Intergenic
1096193312 12:49633785-49633807 CTGGGAAGGACTGGGGCCAGAGG - Intronic
1096772734 12:53946349-53946371 GTGGGAAGGGAAGAGGCAAGGGG - Exonic
1097055390 12:56246000-56246022 AAGACAAGGATTGAGGCCAGTGG - Intronic
1097847494 12:64381679-64381701 ATGGGAAGGAATGAGTTTGGAGG + Intronic
1098169543 12:67732856-67732878 GTGGGACGGAATGAGTTCAGAGG - Intergenic
1098882382 12:75929667-75929689 ATGGGAAGGCAGTAGCCCAGTGG - Intergenic
1100316587 12:93450297-93450319 ATGGGAATGCATGAGGCCAGAGG + Intergenic
1100385870 12:94104223-94104245 GTGGAAAGGAAGGAGGGCAGAGG + Intergenic
1100398500 12:94205889-94205911 ATAGGAAGGCATGAAGCCAGGGG + Intronic
1100567005 12:95806284-95806306 AAGGGAATGAAAGAGGCCGGAGG - Intronic
1101101174 12:101394194-101394216 ATGTGAGGGGAAGAGGCCAGAGG + Exonic
1101334163 12:103781557-103781579 ATGGGAAGGATGCAGGCGAGAGG - Intronic
1101445562 12:104734616-104734638 ATGGGGAGGAATGAGGACCTGGG + Intronic
1101937743 12:109071823-109071845 AGTGGTGGGAATGAGGCCAGGGG + Intronic
1101997569 12:109535855-109535877 AAGGTAAAGAATGAGGGCAGAGG - Exonic
1102157284 12:110741647-110741669 GTAGGAAGGAAGGTGGCCAGTGG - Intronic
1102682845 12:114702277-114702299 GTGGAAAAGAATGAGGACAGTGG + Intergenic
1102946702 12:116995787-116995809 ATGACAAGAGATGAGGCCAGAGG - Intronic
1104277055 12:127338994-127339016 ATAGGAATGAATGAATCCAGAGG - Intergenic
1104983771 12:132585506-132585528 ATGTGAGGGAAGGCGGCCAGCGG - Intergenic
1104996084 12:132657644-132657666 ATTGGATGGACTAAGGCCAGGGG - Intronic
1106354174 13:28963898-28963920 CTGGGAAGCAGTGAAGCCAGAGG - Intronic
1106883629 13:34158963-34158985 GTGGGCAGGAAAGAGGCAAGTGG + Intergenic
1107403953 13:40095706-40095728 CTGAGAAGGACTGTGGCCAGAGG - Intergenic
1107446073 13:40471457-40471479 GAGGGAGGGAATGAAGCCAGAGG + Intergenic
1108355296 13:49624565-49624587 AAGGGAAGGCAGGGGGCCAGGGG - Intergenic
1108483913 13:50905828-50905850 AAGGGAAGGAATGATGCTTGTGG + Intergenic
1109113153 13:58348982-58349004 ATGGTCTGGGATGAGGCCAGAGG + Intergenic
1109944772 13:69419771-69419793 AGTGGGAGGAATGAGCCCAGTGG - Intergenic
1111997109 13:95175974-95175996 ACGGGAAGGAGTGAGGCCTGTGG - Intronic
1112939759 13:104847502-104847524 AGGGGAAGAAATGAGGTCACAGG + Intergenic
1113030077 13:105983284-105983306 TTAGGAAGGAAGGAGGCCTGGGG + Intergenic
1113508045 13:110830740-110830762 CTGGGGTGGGATGAGGCCAGAGG + Intergenic
1114495064 14:23126660-23126682 AGGGGCAGGAAAGAGGGCAGAGG + Exonic
1115954534 14:38763568-38763590 ATGAAAAGTAAGGAGGCCAGAGG - Intergenic
1117753247 14:58945668-58945690 ATGTGAAGAAGTGAGGTCAGGGG - Intergenic
1117931006 14:60839962-60839984 AGGGGGTGGAATGAGCCCAGCGG + Intronic
1118384353 14:65243433-65243455 ATGGGAGAGAATAAGACCAGAGG + Intergenic
1118898714 14:69968897-69968919 ATGGGGAGAAATGAAGCCACAGG + Intronic
1119046093 14:71320390-71320412 AGGGGAAGGAATGGGGCGGGAGG + Intergenic
1119327861 14:73772223-73772245 TTGGGTGGGAAGGAGGCCAGGGG - Intronic
1119762463 14:77161196-77161218 ATGGGAAGGAGAGTGGACAGAGG - Intronic
1120010903 14:79413144-79413166 GTGGGAAGTAATGATGGCAGAGG - Intronic
1120713889 14:87819779-87819801 TTGGGAAGGAATGAGGCCCAGGG - Intergenic
1120732903 14:88022995-88023017 ATGGGAAGGAACAAGGGCAGGGG - Intergenic
1122881317 14:104691709-104691731 GTGGGAAGGAGAGAGGGCAGGGG + Intronic
1122916979 14:104864001-104864023 TTGGGGAGGAGGGAGGCCAGGGG - Intergenic
1123072732 14:105649563-105649585 GGGGGATGGTATGAGGCCAGAGG + Intergenic
1123098319 14:105776788-105776810 AGGGAACGGAATGAGGCCAGAGG + Intergenic
1123432043 15:20226175-20226197 AAGGGAAGAAATGATGCCATTGG - Intergenic
1124045801 15:26148795-26148817 AGGAGAAGGAATCAAGCCAGAGG - Intergenic
1124192272 15:27590749-27590771 AAGGGAAGGAAGGAGGCCAGTGG - Intergenic
1124632464 15:31345417-31345439 ATGGGAAAGAGGCAGGCCAGCGG - Intronic
1124903101 15:33842712-33842734 TTGGAAAGGAATGAGGACTGAGG + Intronic
1125204010 15:37130587-37130609 AAGAGAAAGAATGAGACCAGGGG - Intergenic
1125532540 15:40423020-40423042 AGGGGGAGGACTGAGGCCAGAGG - Intronic
1126145473 15:45469368-45469390 AGGGGAATGAATAAGGGCAGGGG - Intergenic
1127805534 15:62516617-62516639 ATGGGAAGAAAAGAGACAAGAGG - Intronic
1127854197 15:62941420-62941442 TTAGGCAGGAATGAGGCCAAAGG - Intergenic
1128539757 15:68518421-68518443 AAGGCAGGGAATGAGGACAGGGG - Intergenic
1128888836 15:71312680-71312702 AGAGGAAGGTATGAGGCCAGAGG - Intronic
1128945187 15:71814898-71814920 AAGGTAAGGAATGAGGGAAGAGG + Intronic
1129076715 15:73003160-73003182 ATGTGAAGGAATGAGTCCTGAGG + Intergenic
1129183088 15:73889136-73889158 ATGGGCAGGATGAAGGCCAGGGG + Exonic
1129388782 15:75210209-75210231 GTGGGAGGGAGTGAGGACAGGGG - Intronic
1129538116 15:76330550-76330572 TTAGGAAGGGATGAGGCCATGGG - Intergenic
1129771829 15:78207786-78207808 ATGGAAAGGAATGAGGGATGGGG - Intronic
1129983869 15:79898579-79898601 ATGGGAAGGAAGGAGGGAAGAGG + Intronic
1131307399 15:91257737-91257759 ATGGGAAGGGGTGCAGCCAGAGG - Intronic
1131833462 15:96368632-96368654 AGGCCAAGGAAAGAGGCCAGAGG - Intergenic
1132663303 16:1071002-1071024 GTGGGTGGGACTGAGGCCAGGGG + Intergenic
1132690863 16:1181240-1181262 ATGGGCAAGGGTGAGGCCAGAGG + Intronic
1132937026 16:2486370-2486392 ATGGGAAGAAGTGAGACGAGCGG + Intronic
1133268240 16:4597485-4597507 TTGGGAATGAATGAGCCAAGGGG - Intronic
1133485259 16:6213856-6213878 ATGGGAGGGGATGGGGTCAGGGG + Intronic
1133975266 16:10596007-10596029 AGTGGCAGGAATGAGGTCAGAGG + Intergenic
1134314691 16:13107793-13107815 ATGGGGATGAATGAGGGCAGTGG + Intronic
1134859329 16:17547124-17547146 AGGGAAAGGATTGAAGCCAGAGG - Intergenic
1135173323 16:20206194-20206216 ATGGGAAGTAATGGAGGCAGAGG - Intergenic
1135498484 16:22973403-22973425 ATGGAAAGAGATGAAGCCAGAGG + Intergenic
1135689722 16:24526505-24526527 ATGGGGTGGAATGAAGCTAGAGG + Intergenic
1135803687 16:25522940-25522962 ATAGGGAGGAATGAGCACAGAGG - Intergenic
1136073715 16:27804429-27804451 ATGGGGAGGAAACAGGGCAGGGG - Intronic
1136606450 16:31337471-31337493 GTGGGAAGGAATGAAGGGAGAGG - Intergenic
1137017967 16:35394835-35394857 AGGGGAGGGACTGAGGCCTGGGG - Intergenic
1137362005 16:47826925-47826947 ATGGGAAGAAACTGGGCCAGTGG - Intergenic
1137363853 16:47843660-47843682 ATGGGAAGAAATGACTGCAGTGG - Intergenic
1137509585 16:49087245-49087267 ATGTGAATGAAGGAGGCAAGGGG + Intergenic
1137586481 16:49666895-49666917 GTGGGAAAGCATGATGCCAGGGG + Intronic
1138013519 16:53407612-53407634 ATTTGAAGGAAAGAGGACAGGGG - Intergenic
1138096461 16:54215599-54215621 ATGAGGAGGAATGTGGCCATTGG + Intergenic
1138207012 16:55132656-55132678 ATGGGAAGGAGAGAGGGGAGGGG + Intergenic
1138311066 16:56024457-56024479 ATGGGGAGGACTGAGGAGAGTGG - Intergenic
1138311202 16:56025257-56025279 ATGGGAAGGACTGAGGAGTGAGG - Intergenic
1138428387 16:56951552-56951574 ATTTGTAGGGATGAGGCCAGAGG + Intergenic
1138568613 16:57852415-57852437 AAGAGAAGGCAGGAGGCCAGAGG + Intronic
1138574303 16:57897731-57897753 CTGGGAAAGAAGGCGGCCAGCGG - Intronic
1138625587 16:58249026-58249048 ATGGGGATGAAAGAGGACAGAGG - Intronic
1138877536 16:60970864-60970886 ATGGGAAAGAATGAGATCATAGG + Intergenic
1139399661 16:66671290-66671312 AGGGGAAGGAATCAGGCAAGCGG + Intronic
1139420386 16:66845878-66845900 AAGGGAAGGACAGAGGACAGAGG + Intronic
1140657495 16:77155563-77155585 ATAGGAAGCAATGGGGCAAGGGG + Intergenic
1141021087 16:80497153-80497175 AGGGGAAGGTATGTGGCAAGGGG - Intergenic
1141392198 16:83674329-83674351 ATGGGAAGATATGATGCCTGGGG - Intronic
1142265543 16:89062579-89062601 AGGGGAGGGAGTGAGGTCAGTGG + Intergenic
1203114196 16_KI270728v1_random:1473432-1473454 AAGGGAAGAAATGATGCCATTGG + Intergenic
1142667134 17:1469617-1469639 AAGGGGAGGAGTGAGGTCAGAGG + Intronic
1143086696 17:4421452-4421474 ATGGGAAAGAAAGGGGCCACAGG - Intergenic
1143851178 17:9813221-9813243 GTGTGAAGGAATGAGGCCTACGG - Intronic
1144881282 17:18432056-18432078 ATGGGAAGGAGTGAGGGTGGGGG + Intergenic
1145150950 17:20512330-20512352 ATGGGAAGGAGTGAGGGTGGGGG - Intergenic
1146557886 17:33842269-33842291 ATGGGATGGGATGGGGCCATGGG + Intronic
1146807775 17:35878917-35878939 AAGGGCAAGAATGAAGCCAGAGG - Intronic
1147738302 17:42654933-42654955 AGGGTAAGGTATGAGGGCAGGGG - Intergenic
1148567732 17:48643437-48643459 ATGGGAAGGAGTGAGGGCTTTGG + Intergenic
1148622558 17:49045289-49045311 ATGGGAAGGAAAGAAGTCTGAGG + Intronic
1148801513 17:50229498-50229520 AAGGGAAGGAAAGAGGGAAGGGG + Intergenic
1149437482 17:56645299-56645321 AGGGGAGGGGATGAGGGCAGAGG - Intergenic
1151272116 17:73004840-73004862 ATTGGAAGGAAAGGGGCCATCGG + Intronic
1152196942 17:78923955-78923977 ATAAGAAGGAAGGAGGGCAGGGG + Intronic
1152272596 17:79333802-79333824 AAGGGCAGGAATGGGGGCAGAGG - Intronic
1153019562 18:614567-614589 ATGGGAGGGTGAGAGGCCAGGGG - Intronic
1153940776 18:9974534-9974556 GTGGGAAGGAATGAGGCCTCAGG + Intergenic
1154956230 18:21258284-21258306 TTGGCAAGGAATGGTGCCAGTGG + Intronic
1155267046 18:24104342-24104364 TAAGGAAGGAAGGAGGCCAGTGG - Intronic
1155947439 18:31871552-31871574 CTGGGAAGAAGTGATGCCAGTGG - Intronic
1156253751 18:35376640-35376662 GTGGGAAGGGTTGAGGCCACCGG + Intronic
1157254623 18:46127384-46127406 ATAAGAAGTAATGAGGACAGTGG + Intronic
1157584479 18:48792318-48792340 ATGGGAAGGCATCAGGTCAGCGG + Intronic
1157757453 18:50231413-50231435 AAGGGAAAGAGAGAGGCCAGAGG - Intronic
1158341452 18:56471177-56471199 AGGGAAAGGAAAGAGACCAGAGG + Intergenic
1158403517 18:57141450-57141472 AAGGGAAGGAAATAGGCCTGAGG + Intergenic
1158630445 18:59109411-59109433 ATTGAAAGGAAGGAGGGCAGAGG + Intergenic
1160040921 18:75344859-75344881 ATGGGAAGGCAGGAAGCCTGGGG - Intergenic
1160308592 18:77766692-77766714 GTTAGAAGGAAGGAGGCCAGGGG - Intergenic
1160564113 18:79776413-79776435 ATGGGAATGAATGAGCTGAGCGG - Intergenic
1161608152 19:5226084-5226106 ATGGCAAGGAGTGAGGGGAGCGG - Intronic
1162891895 19:13739571-13739593 AAAGGCAGGAATAAGGCCAGTGG - Intronic
1164220494 19:23188772-23188794 AAGGGAAGAAATGACGGCAGTGG + Intergenic
1164554839 19:29243471-29243493 ATGGATTGGAATTAGGCCAGGGG + Intergenic
1164832238 19:31331641-31331663 GTTGCAAGGAAGGAGGCCAGCGG + Intronic
1165063435 19:33215988-33216010 ATGGGGAGGCATCAGGCCTGGGG + Intronic
1165164210 19:33840133-33840155 ATGGTAAGGAATAAGGACATTGG + Intergenic
1166338331 19:42122292-42122314 GTGGGAAGGAATGGGGAGAGGGG - Intronic
1166432729 19:42740837-42740859 ATGGGGATGAAAGAGGCCAAAGG - Intronic
1166435837 19:42766065-42766087 ATGGGGATGAAAGAGGCCAAAGG - Intronic
1166448700 19:42880053-42880075 ATGGGGATGAAAGAGGCCAAAGG - Intronic
1166455593 19:42937552-42937574 ATGGGGATGAAAGAGGCCAAAGG - Intronic
1166742219 19:45121470-45121492 ATGGGCGGGATTGAGGCCACTGG + Intronic
1167354713 19:48996171-48996193 GTGGGAAGGAAGGAGACCTGGGG + Intronic
1167486831 19:49767594-49767616 ATGGAATGGGAAGAGGCCAGAGG + Intronic
1167604557 19:50474999-50475021 ATGTGAAGATATGAGGTCAGAGG + Intronic
1167727135 19:51223948-51223970 AAGGGCAGGAATCAGGTCAGTGG + Intergenic
1168148857 19:54434399-54434421 CTGGGAGGGGCTGAGGCCAGAGG - Intronic
925445367 2:3922654-3922676 AGGGGAAGGAAAGAGGGAAGGGG + Intergenic
925704668 2:6673078-6673100 CTAGGAAGGAAGGAGGCCACAGG + Intergenic
926359650 2:12074311-12074333 ATGGGAAGGCACCAGACCAGCGG + Intergenic
926554695 2:14342642-14342664 AAGGGGTGGAATGAGCCCAGTGG + Intergenic
927725604 2:25420139-25420161 TTGGGAAGTGATGAGGGCAGTGG - Intronic
928132311 2:28661394-28661416 ATGGTAAGGGAAAAGGCCAGGGG + Intergenic
929069260 2:38012192-38012214 ATAGGAAGGAATAAAGCTAGTGG - Intronic
929083668 2:38147034-38147056 GTGGGAAGAGATGAGGTCAGAGG - Intergenic
929395858 2:41521463-41521485 TTGGGAAGGAGTGAGGCTGGAGG - Intergenic
929505580 2:42525533-42525555 AGGGGAAGGAATGAAGGAAGGGG - Intronic
929760215 2:44800686-44800708 AAGGGCAGAAGTGAGGCCAGAGG - Intergenic
929916783 2:46142998-46143020 ATGTGAAGGCAGGAGGGCAGAGG + Intronic
930672678 2:54167978-54168000 ATGGGATGGAATGAGGCTCTGGG - Intronic
932264215 2:70353095-70353117 GTGGGAGGAAATGAGGCCACCGG + Intergenic
933401128 2:81797075-81797097 ATAGGTAGTAATGATGCCAGTGG + Intergenic
933789429 2:85872128-85872150 CGGGGAAGGAATGGGGACAGAGG + Intronic
933834001 2:86231470-86231492 ACAGGAAGGCATGAGGCCTGCGG - Intronic
934726772 2:96626329-96626351 AAGGGAAGGAATGAAGGAAGGGG + Intronic
934924318 2:98371313-98371335 ATGAGAAGAAATGAGGCACGAGG - Intronic
935182552 2:100703911-100703933 ATGGGAAGAAAGGAGACAAGAGG + Intergenic
935400108 2:102651364-102651386 AAGGTAAGAAATGAGGACAGAGG - Intronic
936465586 2:112745977-112745999 ATGGGAGGGAAGGAAGGCAGAGG + Intronic
937156715 2:119725008-119725030 ATGGGGAGGAATGATGACAGAGG - Intergenic
938093202 2:128446647-128446669 CTGGGAAGGAAGGAGGAGAGAGG + Intergenic
938377921 2:130820607-130820629 AGGAGAAGGAATGTGGCCTGGGG + Intergenic
939105658 2:137945524-137945546 ATGGGAAGGAAAGACTCCTGGGG + Intergenic
939350601 2:141033076-141033098 AAGGGAATGATTGAGTCCAGGGG + Intronic
940261584 2:151785435-151785457 ATGGGAAAGAAGGAGGCAGGAGG + Intergenic
940485815 2:154294398-154294420 ATGGAAAGGAGTGAGACCATTGG + Intronic
942775062 2:179571817-179571839 CTGGGTAGGAATATGGCCAGAGG - Intronic
942826224 2:180180191-180180213 ATGGGAAGACTTGAGGCAAGGGG - Intergenic
943134329 2:183892222-183892244 AGGGGAATGATTTAGGCCAGTGG - Intergenic
946413315 2:219526495-219526517 ATGGGAGAGAAAGAGGCCAAGGG + Intronic
947400859 2:229730372-229730394 AGGTGAAGGAATGAATCCAGTGG - Intergenic
947740133 2:232481160-232481182 CCGGGAAGGGAAGAGGCCAGGGG + Intronic
947838108 2:233189534-233189556 ATGGGAAGGAACGGGGGCAATGG + Intronic
948391426 2:237614170-237614192 GGGGGAAGGAAAGACGCCAGTGG + Intergenic
948489748 2:238304853-238304875 ATGGTAAGGAATGGGCCCAGTGG + Intergenic
948998024 2:241594087-241594109 ATGAAAAGGAGTGAGGCCTGAGG + Intronic
1169981783 20:11392888-11392910 ATGGGTAGGAAAGAGGTAAGGGG + Intergenic
1170572475 20:17640412-17640434 AAGGGAAGAGGTGAGGCCAGAGG + Intronic
1171190417 20:23155228-23155250 AAGGGAAGGAATGTGGACTGGGG - Intergenic
1171492324 20:25529900-25529922 AAGGCAAGGAATGGGGACAGAGG + Intronic
1172055628 20:32152435-32152457 CTGAGAAGGAATGAGGCATGAGG - Intronic
1172426147 20:34857481-34857503 ATAGGATGGAATGAGCCCATTGG - Intronic
1172527235 20:35607282-35607304 ATGGGAAGGAAAGAGGCAGAGGG + Intergenic
1172900640 20:38332116-38332138 ATCGGAAGAGATGTGGCCAGAGG + Intronic
1173867860 20:46323985-46324007 AAGGGAAGCAGAGAGGCCAGAGG - Intergenic
1174484120 20:50850922-50850944 AAGGGAGGTAATGAGGCCATGGG + Intronic
1175001210 20:55632609-55632631 AGTGGGCGGAATGAGGCCAGTGG - Intergenic
1175638072 20:60602270-60602292 ATGAGAAAGAGTGAGGCCAAAGG - Intergenic
1176411570 21:6451999-6452021 CTGGGAGGGGAGGAGGCCAGCGG - Intergenic
1177384375 21:20389698-20389720 AAGGAAAGGATTGAGGGCAGGGG + Intergenic
1178176495 21:30105805-30105827 ATGGGAAGATTCGAGGCCAGTGG - Intergenic
1178337320 21:31755018-31755040 GCGGAAAGGACTGAGGCCAGAGG - Intergenic
1178677698 21:34645126-34645148 TTGTGAAGGGATGATGCCAGTGG + Intergenic
1179231315 21:39506364-39506386 GTGGTGAGGGATGAGGCCAGAGG + Intronic
1179245754 21:39632803-39632825 AGAGGAAGGAATGAGCCAAGAGG + Intronic
1179578350 21:42321598-42321620 ATGGGAATGAAAGAGTCCACTGG - Intergenic
1179687064 21:43060321-43060343 CTGGGAGGGGAGGAGGCCAGCGG - Intronic
1180230967 21:46426607-46426629 AAGGGGAGGAATGAGGCCGGAGG - Intronic
1181309546 22:21937229-21937251 AGGAGAAGGGCTGAGGCCAGAGG + Intronic
1182347559 22:29677372-29677394 ATGGGAAGGCAGTAGTCCAGGGG + Intronic
1184359686 22:44007485-44007507 GAGGGAAGAAATGAGTCCAGAGG - Intronic
1184391819 22:44207345-44207367 GTGGGGAGGAGTGAGGCTAGTGG + Exonic
1185046364 22:48530605-48530627 ATGGGAAGGGAGGGAGCCAGGGG - Intronic
949554782 3:5143531-5143553 AAGGGAAGGAACAAGACCAGTGG - Intronic
950146963 3:10656959-10656981 AGGGAAAGAGATGAGGCCAGCGG + Intronic
950454517 3:13084664-13084686 ATGGGCAGAACTGAGGACAGGGG + Intergenic
950585590 3:13890157-13890179 ATGGGAAGTAGGGAGTCCAGAGG - Intergenic
950868792 3:16211329-16211351 CTGGGAAGGAATGAGGCTGTGGG + Intronic
951709317 3:25573168-25573190 CAGGGAAGGAAGGCGGCCAGCGG - Intronic
951867560 3:27324852-27324874 GTGGAAAGACATGAGGCCAGAGG - Intronic
952698528 3:36299095-36299117 CTGGGAAGGAATGAAGGCAGGGG + Intergenic
953054506 3:39377268-39377290 AATGGAAGGGAGGAGGCCAGAGG - Intergenic
953708778 3:45251996-45252018 AGAGGAAGGAATGAGGGCATTGG + Intergenic
953996284 3:47522517-47522539 CTGTGAAGGGATGAGGGCAGTGG - Intergenic
954549411 3:51468082-51468104 GTGGAAAGAAAGGAGGCCAGGGG + Intronic
954862041 3:53698687-53698709 ATGGGAATGAATTAGGCCAAAGG - Intronic
954966142 3:54612740-54612762 CTGGGAAGGGATAAGACCAGCGG + Intronic
955056112 3:55457504-55457526 ATGTCAAGGAATGAGGCCCAGGG + Intergenic
955694582 3:61623196-61623218 AGGGGCAGGAATCAGGACAGTGG + Intronic
955963942 3:64368861-64368883 TTGCGAAGGAGTGAGGACAGTGG - Intronic
957940662 3:86999016-86999038 TTTGGAAGAAATGAAGCCAGAGG + Intergenic
958436905 3:94108001-94108023 ATGGAAATGATAGAGGCCAGAGG - Intronic
960052224 3:113249826-113249848 GTGGAGAGGAATGAGGCCTGAGG + Exonic
960590469 3:119360960-119360982 ATGGGAAGGACTGACGCTGGAGG - Intronic
960662202 3:120072812-120072834 ATGGGAAATAATAAGGACAGAGG + Intronic
960964843 3:123097607-123097629 ATGTGAAAGAATGTGGCTAGAGG - Intronic
961161546 3:124730773-124730795 ATGAGAAGCACAGAGGCCAGGGG + Intronic
961345959 3:126263555-126263577 CTTGGAAGGGATGAGGCTAGAGG + Intergenic
961552050 3:127674992-127675014 AGCCGAAGGAATGAGGCCAGTGG - Intronic
961665813 3:128492674-128492696 ATGGGAAGACAAGAGGCCCGAGG + Intronic
961683689 3:128615766-128615788 ATGGGAAGGAAGGAGGTAACAGG - Intergenic
961736628 3:129005740-129005762 ATGGTAAGGCATGGGGCTAGAGG + Intronic
962003642 3:131326691-131326713 ATGGGAAGGGATGTGGCTGGAGG - Intronic
962418514 3:135206005-135206027 ATGGGGAGGGATGAGGTTAGGGG - Intronic
963300465 3:143591872-143591894 TTGGGAAGGAGGGAGGTCAGTGG + Intronic
963849899 3:150200813-150200835 ATGGAAAGGAATAAGGACTGGGG - Intergenic
963962153 3:151321882-151321904 ATGGGAAGAAAGGAAGTCAGAGG - Intronic
964421880 3:156511883-156511905 ATGGGAGGGAAGGAGGACAGGGG - Intronic
964726210 3:159816727-159816749 GTGGTAAGAAATGAGACCAGAGG - Intronic
964828099 3:160851770-160851792 ATGGGAAGGAAGGAGGAAGGTGG + Intronic
966624897 3:182005359-182005381 ATTGGAAGAAATGAGGCATGAGG + Intergenic
967142800 3:186576363-186576385 AGGGGAAGGAATTAGGGTAGAGG + Intronic
968087273 3:195879439-195879461 ATGGAAAGGAAGGAGGTCAGAGG + Intronic
969242294 4:5907763-5907785 ATGGAAAGCAATAGGGCCAGGGG + Intronic
969279998 4:6163491-6163513 ATGGGGAGGCCTGAGGCCATGGG - Intronic
969713820 4:8859021-8859043 GTGGGGAGGAAGGAGGCCGGTGG + Intronic
970150107 4:13080667-13080689 GTTGGAACTAATGAGGCCAGCGG + Intergenic
971110251 4:23576923-23576945 CTGGGAAGCAATGAGGTCAGAGG + Intergenic
971385667 4:26138790-26138812 ACAAGAAGGAATGAGGCCTGAGG + Intergenic
975519981 4:75290158-75290180 ATGCCAAGCGATGAGGCCAGGGG - Intergenic
975684047 4:76902270-76902292 GTGGGAAGAAATGAGGGTAGAGG + Intergenic
976435958 4:85018511-85018533 ATGGGAAGGGGTGGGGGCAGCGG - Intergenic
976785526 4:88815324-88815346 ATGGGAAATAGTGGGGCCAGGGG - Intronic
977064530 4:92296841-92296863 ATGGGAAAGAATGAGGACCAGGG - Intergenic
977224266 4:94375767-94375789 AGGGGAGGGGATGAGGCAAGTGG - Intergenic
977257057 4:94753051-94753073 CTGGGAAGCAATGAGGTCTGTGG - Intergenic
977436549 4:97003791-97003813 ATGGGATAAAATGAAGCCAGAGG - Intergenic
978979869 4:114930062-114930084 AAGGGAAGGAATGAAGAGAGAGG + Intronic
980973529 4:139588867-139588889 ATGGGGAGGCATGAGGCATGTGG + Intronic
981174380 4:141663835-141663857 TTGGGGAAGAATGAGGCTAGGGG + Intronic
981379656 4:144058182-144058204 AAGGGAAGGAATGAAGGAAGGGG - Intergenic
983104765 4:163672974-163672996 AAGGGGAGGAAGGAGGGCAGTGG - Intronic
983975240 4:173925909-173925931 TTGGGAAGCTATGAGGTCAGGGG - Intergenic
984884642 4:184439525-184439547 ATGGGAAAACAGGAGGCCAGTGG + Intronic
985746463 5:1651550-1651572 CTGGGGAGGGATGAGGCCTGGGG + Intergenic
985746493 5:1651616-1651638 ATGGGGAGGGGTGAGGCCTGGGG + Intergenic
985746515 5:1651665-1651687 ATGGGGAGGGGTGAGGCCTGGGG + Intergenic
985870257 5:2548774-2548796 AGGGGCAGGTATGAGGGCAGGGG - Intergenic
986721222 5:10563124-10563146 AAAGGAAGGAAGGAGGCTAGGGG + Intergenic
987026315 5:13930185-13930207 GCAGGAAGGAATGAAGCCAGTGG + Intronic
987043476 5:14085097-14085119 ATGAGAAGGAAGGAGGACTGAGG - Intergenic
987724445 5:21679620-21679642 ATGGAAAGGAATAAGGTCTGAGG - Intergenic
987750931 5:22038185-22038207 ATGGAAGGGTATTAGGCCAGTGG - Intronic
988849392 5:35163530-35163552 AGTGGAAGGAGTGAGGACAGTGG + Intronic
989111963 5:37915045-37915067 AGGGGGATGAATGAGCCCAGAGG + Intergenic
989645792 5:43631215-43631237 AAGTGTAGGAATGAGGCCTGTGG + Intronic
990978618 5:61581206-61581228 ATGGGAAGGAGTGGGCTCAGAGG + Intergenic
991137678 5:63201794-63201816 ATGGGAAACAATGGGGACAGAGG - Intergenic
992674496 5:79092222-79092244 TTGGGAAGGAAAGAGTCAAGTGG - Intronic
994502832 5:100601693-100601715 ATGAGAATGAATGAGGTCACCGG + Intergenic
995584569 5:113634806-113634828 AAGGGAAGTAATGATGCTAGAGG - Intergenic
996056545 5:118988668-118988690 CTGGGAAGGAACGAGCCCATTGG + Intergenic
996626952 5:125581390-125581412 ATTGGAAGGAATAAGGTCTGGGG + Intergenic
996709696 5:126532100-126532122 AAGGAAGGGAATGAGGCCAGGGG + Intergenic
997212501 5:132085741-132085763 ATGGTGAGCAATGAGGCTAGAGG - Intergenic
998031847 5:138877213-138877235 ATAGGAAGGATTAAGGTCAGAGG - Intronic
998405908 5:141874608-141874630 CTGGGAAGGGATGAGAACAGAGG + Intronic
998682678 5:144487676-144487698 ATGGGAAGGAATGCTGCCTTTGG - Intergenic
998739258 5:145180253-145180275 TTGGAAAGAAATGAAGCCAGAGG - Intergenic
998888229 5:146717736-146717758 ATGGTAAGGAGGGAGGTCAGGGG - Intronic
998910861 5:146958750-146958772 ATCTGAAGGAAAGAGGGCAGAGG - Intronic
999242956 5:150138148-150138170 ATTGGCAGGAAGGACGCCAGAGG + Intronic
1001483702 5:172105247-172105269 AAGGGAAGGAGCAAGGCCAGTGG - Intronic
1001954176 5:175837080-175837102 AAGGGAGTGAATGAGACCAGTGG - Intronic
1002034141 5:176453185-176453207 ATGGGAAAGAATAAGGACATAGG + Intronic
1003260291 6:4510624-4510646 CTGGAAAGGGATGTGGCCAGTGG - Intergenic
1003859623 6:10310461-10310483 ATGTGATGGAAAAAGGCCAGGGG - Intergenic
1004016355 6:11735623-11735645 ATGGATAGGAGTGAGGCCTGAGG + Exonic
1004185661 6:13419306-13419328 GGGGGAAGGAAGGATGCCAGAGG + Intronic
1004373843 6:15075191-15075213 ATGGGAAGGGATGGGCACAGAGG - Intergenic
1005993975 6:30920763-30920785 GTAGGAAGGACTGGGGCCAGGGG + Intronic
1007097759 6:39224628-39224650 TTAGGAAGGAAGGAGGCCAGTGG + Intronic
1007176431 6:39901033-39901055 AGGGGTAGGCATGAGGTCAGGGG - Intronic
1007324413 6:41049130-41049152 AAGGGAAGGACAGAGACCAGTGG - Intronic
1007479868 6:42142685-42142707 GCGGGAAGGAATGCGGCCTGGGG - Intergenic
1007487969 6:42195392-42195414 AAGGGAAGGAGTGAGGCTGGAGG - Intergenic
1007905750 6:45458984-45459006 AGGGGAAGGAAGAAGGCAAGTGG - Intronic
1008312558 6:49994208-49994230 ATGAGAATGACTGAGGTCAGTGG + Intergenic
1008884266 6:56414815-56414837 ACAGGAAGGAAGGAGTCCAGGGG + Intergenic
1010342367 6:74769336-74769358 ATGGGTAGGAGTGAGGGCAGAGG + Intergenic
1010788133 6:80029644-80029666 AGGGGAAGGAGTGAGGCCCAAGG + Intronic
1011042620 6:83047613-83047635 CTGGCAAGGAATGTGGCCTGTGG + Intronic
1011252198 6:85383592-85383614 ATGTGAAAGAATGAGGGAAGAGG - Intergenic
1011554931 6:88564204-88564226 AGGGGGAGGAGTGAGCCCAGTGG - Intergenic
1011561432 6:88621124-88621146 ATGAAAAGGACTTAGGCCAGAGG - Intronic
1011862147 6:91772189-91772211 AAGGGAAGAAATGAGACAAGAGG + Intergenic
1014719452 6:124898337-124898359 ATGGGAAGGAAGGTGGGCATGGG - Intergenic
1015022215 6:128490467-128490489 AAGGGGAGGAAAGATGCCAGAGG + Intronic
1015115462 6:129644097-129644119 ATGGGTGGGAATTAGGACAGGGG + Intronic
1015994025 6:138979575-138979597 GTGGGCAGGAATGTGGCCATTGG - Intronic
1016013781 6:139164165-139164187 ACTGGAAGTAAGGAGGCCAGAGG - Intronic
1017929443 6:158939333-158939355 ATGGGAAGGACGTAGGGCAGAGG - Intergenic
1018180914 6:161222803-161222825 GTGCAAATGAATGAGGCCAGAGG - Intronic
1018242474 6:161791530-161791552 ATGGGAAAGAATCAGGCAAATGG - Intronic
1018429695 6:163713405-163713427 ATGGGAAGGAGTGGGGGGAGGGG - Intergenic
1018503925 6:164443653-164443675 ATGGGAAAGAATGACCCCAAAGG + Intergenic
1018842223 6:167525479-167525501 ATATGAAGGAGTCAGGCCAGAGG - Intergenic
1018907651 6:168084823-168084845 ATGGGGAGGAATGAGGTGGGAGG - Intergenic
1018931172 6:168241342-168241364 ATGGGCAGGGATCAGGTCAGCGG + Intergenic
1019104417 6:169656877-169656899 ATGAGGAGGAAGGAGGTCAGAGG + Intronic
1019226263 6:170512554-170512576 AAGGGAAAAAATGAGGTCAGGGG + Intergenic
1019263062 7:93134-93156 ATGAGAAGGAGTGAGGGCACAGG - Intergenic
1019887274 7:3916166-3916188 AGAGGAGGCAATGAGGCCAGTGG + Intronic
1020148299 7:5662170-5662192 ATGGGATGGAATCAGACCTGAGG + Intronic
1020378490 7:7515018-7515040 ATGAGAAGCAGGGAGGCCAGAGG + Intronic
1021043266 7:15889873-15889895 TTTGGAAGAAATGTGGCCAGAGG + Intergenic
1021683431 7:23157922-23157944 ATGGGAAGAAATGAGGAAAATGG + Intronic
1021895639 7:25232670-25232692 GTGAGAAGGAGAGAGGCCAGTGG - Intergenic
1022581788 7:31562739-31562761 ATGAGAAGGAATAAGACTAGAGG - Intronic
1023417373 7:39946168-39946190 ATGGAATGGAATGAGGACATGGG + Intergenic
1023552899 7:41388472-41388494 GAGGGAAGGCATGAGGTCAGAGG - Intergenic
1024202766 7:47122985-47123007 ATGGTAAGGGATGAAGCCAGAGG + Intergenic
1024569079 7:50709474-50709496 AGGAGAGGGAGTGAGGCCAGGGG - Intronic
1025717321 7:63972847-63972869 ATGGGAAGGAAAGAGACAAGGGG - Intergenic
1026396927 7:69964892-69964914 AAGGAAAGGAGTGAGGCCAGAGG - Intronic
1026416166 7:70183028-70183050 AATGGGAGAAATGAGGCCAGTGG + Intronic
1027371827 7:77514279-77514301 ATGTGAAGAAATGAAGCCAAAGG + Intergenic
1027980227 7:85209457-85209479 ATGGGGAGGAAGAAGGACAGTGG + Intergenic
1030780066 7:113589736-113589758 ATGGGGAGGGGTGAGGCCTGTGG - Intergenic
1031203148 7:118717450-118717472 ATGTGAATGAATGAGTACAGAGG + Intergenic
1031970115 7:128058743-128058765 ATGGGAAGAAATGATGCATGTGG - Intronic
1032283166 7:130522617-130522639 ATGGGGTGGAAGGATGCCAGAGG + Intronic
1032434858 7:131891913-131891935 ATGGGAAGGAAAGAAAGCAGAGG + Intergenic
1033709630 7:143928505-143928527 ATGGGAAGTGATGAGGCATGTGG + Intergenic
1034105945 7:148489943-148489965 ATGGGAAGAAATGAGATTAGAGG - Intergenic
1034509347 7:151520894-151520916 GTGGGGAGGAATGAAGCCAGGGG + Intergenic
1035143919 7:156793964-156793986 AAGGTAGGGAAAGAGGCCAGCGG - Intronic
1035203919 7:157282425-157282447 TGGGGCAGGGATGAGGCCAGAGG - Intergenic
1035270200 7:157715255-157715277 GTGGGAATGAATGAGGCCCAGGG + Intronic
1035744165 8:1949872-1949894 ATGGGAGGGAATGCTACCAGGGG - Intronic
1036807689 8:11846795-11846817 ATGGGAAGGAACTAGCCCAGAGG + Intronic
1037939967 8:22943984-22944006 ATGGGAAGGAAAGAAGGAAGGGG - Intronic
1038213260 8:25539488-25539510 ACGGGAAGGAGGGATGCCAGAGG + Intergenic
1038429267 8:27486600-27486622 AGGTGAAGGAAACAGGCCAGAGG - Intergenic
1041177485 8:55211596-55211618 ATGGGAAAGAATGTGGGCATGGG + Intronic
1041333289 8:56751653-56751675 ATGCCAAGGAATGAGGTGAGTGG + Intergenic
1041929403 8:63270464-63270486 ATGGGGAGAAGTGAGGCCTGTGG - Intergenic
1043827634 8:84948667-84948689 ATGGAAAGGAAGAAGGCCTGGGG - Intergenic
1045480281 8:102586279-102586301 AGAGGAAGGAAGGAGGCCTGTGG + Intergenic
1046652419 8:116851821-116851843 ATGGTAAGGAATGAGTCCAGAGG - Intronic
1047375212 8:124289254-124289276 AAGGGGAGGAGTCAGGCCAGGGG + Intergenic
1048776755 8:137955065-137955087 ATGGGAAGGAATTTTGCCAATGG - Intergenic
1049164780 8:141119092-141119114 AGGGGAAAGCCTGAGGCCAGGGG + Intronic
1049211916 8:141390876-141390898 ATGGGAAGGATGGAGGCCCTGGG + Intergenic
1049435242 8:142583459-142583481 TGGGGAAGGAGTGAGCCCAGGGG - Intergenic
1049767210 8:144360456-144360478 ATGGCCAGGAAGCAGGCCAGGGG - Exonic
1049948532 9:621951-621973 TTGGGAAGGAAGGAGGGAAGAGG + Intronic
1051192749 9:14532425-14532447 GTGGGAGGGAATGAGGAGAGAGG + Intergenic
1052232098 9:26165904-26165926 AGGGGAAGATTTGAGGCCAGAGG - Intergenic
1052785798 9:32827154-32827176 ACAGCAAGCAATGAGGCCAGTGG - Intergenic
1052929795 9:34047070-34047092 ATGGGAGAGAATGAGGCCATGGG - Intronic
1053425022 9:38004786-38004808 ATGGGAAGGAACACGGCCACAGG + Intronic
1055981854 9:82011531-82011553 ATGGGAAGGAATCTGGACAGAGG + Intergenic
1056590574 9:87963351-87963373 AGGGGTGGGCATGAGGCCAGGGG + Intergenic
1057096348 9:92313572-92313594 ATGGCAAGAAATGAGGCTAGTGG - Intronic
1057139594 9:92718459-92718481 AGGGGGAGGAAGGAGGCCAAGGG + Intronic
1059943875 9:119385954-119385976 ATGGGAAGAAGTGAGGTCAGTGG - Intergenic
1059956628 9:119522690-119522712 ATGGGCAGGAATGAGGGCTGAGG + Intronic
1060403628 9:123362172-123362194 AGGGGTAGGAATGAGACCAGCGG + Intronic
1060791172 9:126486700-126486722 ACAGGGAGGAATGAGGCCTGGGG - Intronic
1060801374 9:126547785-126547807 GTGGGGAGGGATGAGGGCAGAGG - Intergenic
1061159034 9:128882616-128882638 ATGGCAAGGAGAGAGCCCAGAGG - Exonic
1061398427 9:130355682-130355704 TTGGGAGGGTTTGAGGCCAGTGG + Intronic
1061628249 9:131855182-131855204 AAGGGAGGGGCTGAGGCCAGGGG - Intergenic
1061791435 9:133061289-133061311 AGGGGAGGGAAAGAGGCCAGTGG - Intergenic
1203349153 Un_KI270442v1:61469-61491 ATGGGAAGGAATGAAGTCGTAGG + Intergenic
1186517067 X:10174119-10174141 GCGGGAGGGAATGAGGCCAGAGG - Intronic
1187500284 X:19833383-19833405 CTGGGAAGGAAGGAGGACTGTGG - Intronic
1187500301 X:19833444-19833466 CTGGGAAGGAAGGAGGACTGTGG - Intronic
1187500351 X:19833623-19833645 CTGGGAAGGAAGGAGGACTGTGG - Intronic
1187562166 X:20413134-20413156 ACAGGAAGGAATGAGTCGAGTGG - Intergenic
1188519184 X:31018884-31018906 ATGGCAAGGACTCAGACCAGGGG - Intergenic
1189139173 X:38583023-38583045 ATGGGATAAAATGAGGCTAGAGG - Intronic
1189303578 X:39970119-39970141 ATTGGATGGAATTAGACCAGAGG - Intergenic
1189534427 X:41922823-41922845 AGGGGAAGGAGGGAGGGCAGGGG + Intronic
1189537966 X:41956067-41956089 AGTGGAAGAAAGGAGGCCAGTGG - Intergenic
1190056894 X:47186325-47186347 ATGGGCTGGAAAGAGGGCAGCGG + Exonic
1190481096 X:50877684-50877706 ATGGAGAGAAATGAGGTCAGAGG + Intergenic
1190638839 X:52463497-52463519 AGGGGAAGGAATGAAGGAAGAGG - Intergenic
1190653383 X:52589799-52589821 AGGGGAAGGAATGAAGGAAGGGG - Intergenic
1191989419 X:67018170-67018192 TTGGGAAGGAATGAGTGAAGAGG + Intergenic
1192206931 X:69102566-69102588 AAGGGAAGGACTGAGCCCCGGGG - Intergenic
1194102859 X:89728619-89728641 ATGGTAAGGTATGAGGCAAAAGG + Intergenic
1194665313 X:96671279-96671301 AAGGGTAGGAATGAGGTCAAGGG - Intergenic
1195675506 X:107504409-107504431 AGGGGAAGGGAGGAGGCTAGTGG + Intergenic
1196619360 X:117804930-117804952 AGGGGAAGGAAGGAGGTGAGAGG + Intergenic
1196854437 X:119969742-119969764 ATGGCAATGAGTGAGTCCAGAGG - Intergenic
1197838899 X:130724468-130724490 ATGGGTAGGATTGATGCCTGTGG - Intronic
1197971287 X:132118050-132118072 ATGGGAAGGAATCGTGGCAGTGG + Intronic
1198569461 X:137939628-137939650 TTGGGAAGGAATGGGACCTGAGG + Intergenic
1198671112 X:139082077-139082099 GTGGTAGGGAATGAGGTCAGAGG - Intronic
1198863888 X:141099833-141099855 GTGGGAAGAAATGAGGGAAGTGG + Intergenic
1198898800 X:141487582-141487604 GTGGGAAGAAATGAGGGAAGTGG - Intergenic
1198985375 X:142446171-142446193 ATGGTATGGAATGAGGTCAAAGG - Intergenic
1199434321 X:147795898-147795920 ATGGGAAGGAGGGAGGCAGGAGG + Intergenic
1199604130 X:149563221-149563243 ATGGGATGCAATCAGGCCTGTGG - Intergenic
1201589489 Y:15599333-15599355 ATGGGAAGAAAAAAGGCCACGGG + Intergenic
1202085449 Y:21132210-21132232 AGGGCAAGGAATGAGGAAAGGGG + Intergenic