ID: 1063299713

View in Genome Browser
Species Human (GRCh38)
Location 10:4840600-4840622
Sequence CACAGGGATGGGAAGGAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 703
Summary {0: 1, 1: 1, 2: 9, 3: 72, 4: 620}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063299713_1063299723 14 Left 1063299713 10:4840600-4840622 CCTCATTCCTTCCCATCCCTGTG 0: 1
1: 1
2: 9
3: 72
4: 620
Right 1063299723 10:4840637-4840659 CAGCCACATGAAGCTGCTGTGGG No data
1063299713_1063299724 15 Left 1063299713 10:4840600-4840622 CCTCATTCCTTCCCATCCCTGTG 0: 1
1: 1
2: 9
3: 72
4: 620
Right 1063299724 10:4840638-4840660 AGCCACATGAAGCTGCTGTGGGG No data
1063299713_1063299726 22 Left 1063299713 10:4840600-4840622 CCTCATTCCTTCCCATCCCTGTG 0: 1
1: 1
2: 9
3: 72
4: 620
Right 1063299726 10:4840645-4840667 TGAAGCTGCTGTGGGGTCCTTGG No data
1063299713_1063299722 13 Left 1063299713 10:4840600-4840622 CCTCATTCCTTCCCATCCCTGTG 0: 1
1: 1
2: 9
3: 72
4: 620
Right 1063299722 10:4840636-4840658 TCAGCCACATGAAGCTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063299713 Original CRISPR CACAGGGATGGGAAGGAATG AGG (reversed) Intronic
900594448 1:3474386-3474408 CCCAGGGATGTGCAGAAATGGGG + Intronic
900610243 1:3541665-3541687 CCCAGGGAGAGGAAGGCATGTGG - Intronic
901117356 1:6858063-6858085 CCCAGGAATGGGAAGGAATGAGG + Intronic
901774605 1:11551705-11551727 CACTGAGATGGAAAGAAATGTGG + Intergenic
902060858 1:13641252-13641274 CACAGGCATGTGAAGGATTTGGG + Intergenic
902520016 1:17010984-17011006 GCGAGGGAGGGGAAGGAATGAGG - Intronic
902627771 1:17686692-17686714 CACAAGGAAGGGCAGGAGTGGGG + Intronic
902678729 1:18028305-18028327 AAGAGGGATGGGCAGGAAGGAGG + Intergenic
903187026 1:21634565-21634587 CAGAGGGATGGGCAGGAAGGTGG + Intronic
903555554 1:24190616-24190638 CACAGAGATAAGAAGAAATGTGG + Intergenic
903632451 1:24786429-24786451 CACAGGGGTGTGAAGGGAAGAGG + Intronic
903740914 1:25557971-25557993 CGCAGGGAGGGGAAGAAACGTGG - Intronic
903743805 1:25573533-25573555 CACAGGGAAGGGAAGGGAAATGG + Intergenic
903766805 1:25740325-25740347 CCCAGGGACGGGAAGGACTAAGG + Intronic
903996419 1:27307806-27307828 GACTGGGGTGGGAAGGAAGGGGG - Exonic
904092537 1:27955484-27955506 CACAGAGGTGGGAAGGTATGTGG + Intronic
904312236 1:29636250-29636272 CACAGGGATGGTGAGAAGTGGGG + Intergenic
904731860 1:32599027-32599049 CACAGGGATTGGAAGGGTTGGGG - Intronic
904862146 1:33546431-33546453 CACAGGGAGGGGAAGCAAGAAGG + Intronic
905181308 1:36168684-36168706 AAGCTGGATGGGAAGGAATGAGG + Intronic
905515598 1:38559689-38559711 CCCAGGGATGGCAAGGTGTGCGG - Intergenic
905799601 1:40834774-40834796 AACAGGGATGAGATGGAAAGGGG - Intronic
907770651 1:57460235-57460257 CAAGGGGATGGGGACGAATGAGG - Intronic
908404910 1:63805223-63805245 ATCAGGGAGGGGAAGGAACGAGG + Intronic
908412789 1:63883845-63883867 CAGAGGGATGGGCAGCCATGTGG + Intronic
908787167 1:67746592-67746614 CACAGGGATGGAGAGGAATGAGG - Intronic
909753625 1:79195295-79195317 AACAGGGATGTGAAGGAATGTGG - Intergenic
910342568 1:86204444-86204466 CATGGGGATGGAAAGAAATGAGG - Intergenic
910347319 1:86255028-86255050 GAGAAGGATGGGCAGGAATGAGG + Intergenic
911031470 1:93493518-93493540 AACAGGGGTAGGAAGGAATGGGG - Intronic
911816642 1:102360676-102360698 TACAGGGAAGGCAAGGTATGGGG - Intergenic
913025432 1:114833393-114833415 CATAGGGGTGGGAAGGAACTTGG - Intergenic
913085877 1:115436069-115436091 CACAGGGATGGGCAGGAAGAGGG - Intergenic
913099036 1:115546157-115546179 CACAGGGCTGGGAGTGAGTGTGG + Intergenic
913319104 1:117576233-117576255 CTCAGAGATGGGGAGGAGTGGGG + Intergenic
915009845 1:152675369-152675391 CAGAGGGATGGGGAGGATGGAGG + Intronic
915011002 1:152686197-152686219 CAGAGGGATGGGGAGGATGGAGG + Intronic
915311291 1:155007089-155007111 AACTGGGATGGGTTGGAATGTGG + Intronic
915507554 1:156367308-156367330 CTCAGGAATGGGCAGGGATGGGG - Intronic
915518823 1:156429643-156429665 CACAGGCATTGGAAGGAAGAAGG - Intronic
915590104 1:156865806-156865828 CAGAGAGATGGGAAGGATGGTGG + Intronic
915970928 1:160354603-160354625 CACAAGCATGGGAAGGATGGTGG + Intronic
917348839 1:174056490-174056512 CACAGGAATGGGAGGGAGGGTGG + Intergenic
917500892 1:175583942-175583964 CACAGGGAAGCCAAGGAGTGTGG + Intronic
917521749 1:175753508-175753530 CTCGGGGAGGGGAAGGAAGGAGG - Intergenic
917738194 1:177939118-177939140 CACAGGGCTGGGAAGAGACGGGG + Intronic
918610763 1:186488277-186488299 TACAGGGATGGAAAGGTAGGGGG - Intergenic
919244607 1:194964741-194964763 CACTGGGATGGGAGGGAAGGGGG + Intergenic
919982573 1:202651353-202651375 CACAGGGGTGGGTGGGAGTGGGG + Intronic
920854352 1:209651237-209651259 AAAATGGATGGGAAGGAGTGTGG + Exonic
921120383 1:212131211-212131233 CTCAGGGAAGGGAAAAAATGAGG + Intergenic
923052001 1:230395810-230395832 CTCAGGGATGGGGAGGAGTGTGG - Intronic
923121817 1:230999089-230999111 CACAGTGAAGGGAAGGAAGAGGG - Intronic
923665002 1:235991872-235991894 CACAGGGATGGGAGAGCCTGGGG + Intronic
923868571 1:237965948-237965970 TACAGGGATGGGAAGCATTTAGG + Intergenic
923966850 1:239150975-239150997 TAGAGAGATGAGAAGGAATGGGG - Intergenic
924199722 1:241646253-241646275 CCCTGGGATGGAAAGAAATGGGG + Intronic
924368332 1:243320418-243320440 CACGGGCATGGGAAAGAATGTGG - Intronic
924400225 1:243672129-243672151 TATAGGGATGGACAGGAATGAGG + Intronic
924676250 1:246181059-246181081 CTCAAGGATGGGAATGCATGTGG - Intronic
1063299713 10:4840600-4840622 CACAGGGATGGGAAGGAATGAGG - Intronic
1063436311 10:6035118-6035140 CACAGGGCTGAGAAGCAGTGGGG + Intronic
1063768097 10:9165912-9165934 CACAGGAAGTGGAAAGAATGAGG + Intergenic
1063898445 10:10706537-10706559 CTCAAGGATGGGAAGAAAAGAGG + Intergenic
1064002530 10:11675360-11675382 CACAGGGGTGGTGAGGAAGGAGG + Intergenic
1064094241 10:12411336-12411358 CACACAGATGGGAACCAATGTGG - Intronic
1065693007 10:28354505-28354527 CCCTAGGATGGGAAGGACTGGGG - Intergenic
1065859403 10:29858919-29858941 CACAGGGATGGGTAGCAGAGAGG + Intergenic
1066350711 10:34634416-34634438 TCCAGGGGAGGGAAGGAATGTGG + Intronic
1067037445 10:42930876-42930898 CAGAGGGCTGGGTAGGTATGGGG - Intergenic
1067557627 10:47283699-47283721 CACAGAGGTGGGAAGGAGTCAGG + Intergenic
1068643555 10:59438737-59438759 GACAGGGAAGAGAAGGAATCCGG - Intergenic
1069406579 10:68106767-68106789 CACAGGAATGCCAAGGAATCTGG - Intronic
1071101209 10:82039864-82039886 AACAGGGATTGCAAAGAATGAGG - Intronic
1071321539 10:84465038-84465060 CTCAGGGTTGGGAAGCAATCTGG - Intronic
1071354984 10:84784844-84784866 CCCAGGGATGGCAAGGAAGGAGG + Intergenic
1071555160 10:86595921-86595943 CCCTGGGAAAGGAAGGAATGAGG + Intergenic
1071569688 10:86690228-86690250 CACTGGGAGGGGAGGGAAGGAGG - Intronic
1072316243 10:94206086-94206108 CAGAGGGATGGGAAGTGTTGGGG + Intronic
1073446862 10:103586083-103586105 CACAGGGTTTGAAAGGACTGGGG + Intronic
1073455931 10:103636765-103636787 CAGAGGGAGAGGAAGGAGTGGGG - Intronic
1074289598 10:112128346-112128368 CACAGGGAGGGGTAGGAAGACGG + Intergenic
1074563119 10:114552007-114552029 CATAGGGATTGGCAGGAAGGAGG - Intronic
1075570693 10:123540337-123540359 AACAGAGTTGGGAAGGAAGGAGG - Intergenic
1076842223 10:133051243-133051265 AACAGGGATGGGTGGGGATGCGG + Intergenic
1077594281 11:3518204-3518226 CACAGGGATTGGGAGGAGCGGGG + Intergenic
1077891899 11:6424610-6424632 GGCAGGGATGGAAGGGAATGGGG + Intergenic
1078014644 11:7602650-7602672 CACAGGGAAAGGGAGGACTGTGG + Intronic
1078476861 11:11637782-11637804 TACAGGCACTGGAAGGAATGTGG - Intergenic
1078902574 11:15655048-15655070 CACAGAGATGAAAAGGCATGGGG + Intergenic
1079031779 11:16991628-16991650 AGCAGGGATGGGAGGAAATGAGG + Intronic
1079138003 11:17787217-17787239 CACAGGGAAGTCAGGGAATGGGG + Intergenic
1080019305 11:27543504-27543526 CACAGGGCTGGGGAGGCCTGTGG + Intergenic
1080035668 11:27707680-27707702 CAGAGAGATGGGGTGGAATGGGG + Intronic
1080552041 11:33381000-33381022 CACAGGGATTAGAGAGAATGGGG + Intergenic
1080642154 11:34164359-34164381 AGCAGGCATGGGAAGCAATGTGG + Intronic
1080774280 11:35371283-35371305 CACTAGGAAGGGAGGGAATGTGG - Intronic
1082812964 11:57489741-57489763 ACCAAGGATGGGAAGGAAGGTGG + Intronic
1083888524 11:65584408-65584430 CAGAGGGGTGGGAACGAATGGGG + Intronic
1084072059 11:66743268-66743290 AACTGAGATGGGGAGGAATGGGG + Intergenic
1084181559 11:67449309-67449331 CCCAGGGATGGGAAGTGCTGTGG - Intergenic
1084250126 11:67891488-67891510 CACACGGATTGGGAGGAGTGGGG + Intergenic
1084394741 11:68901838-68901860 AGCAGGCATGGGAAGAAATGAGG - Intronic
1084569176 11:69949272-69949294 CACAGGGCTGGGGAGGAGGGTGG + Intergenic
1084695877 11:70755451-70755473 CACAGGGCAGGGATGGGATGAGG - Intronic
1084725157 11:70936949-70936971 CTCAGGGAGGGAAAGGAAGGTGG - Intronic
1084742473 11:71148512-71148534 CCCAGGGATGGCAGGGACTGGGG + Intronic
1084822663 11:71703873-71703895 CACAGGGATTGGGAGGAGCGGGG - Intergenic
1085262630 11:75216506-75216528 CAGATGAATGGAAAGGAATGTGG + Intergenic
1085265642 11:75236435-75236457 CAGAGGGATGGGAAGGCAGCAGG + Intergenic
1085475435 11:76785869-76785891 CACAGAGGTAGGAAGCAATGGGG - Intronic
1085533050 11:77202963-77202985 CACAGGGATGGGTGGGGGTGGGG + Intronic
1086836687 11:91632863-91632885 CATTGGGATGGGGAGGAATGGGG - Intergenic
1087659111 11:100964995-100965017 CGCAGGGCTGGGAAGGACTCGGG + Intronic
1088212705 11:107474209-107474231 GACAGGGAAGGGAAGGAAAAAGG - Intergenic
1088484553 11:110328366-110328388 CACAAGGAAGGGAAGGGAAGGGG - Intergenic
1089752682 11:120662540-120662562 CGCAGGGATGGGAAGAGAAGTGG + Intronic
1089978363 11:122752208-122752230 CCAAGGGATGGGGAGGGATGGGG - Intronic
1090442595 11:126736835-126736857 CACAGGGTGGGGGAGGACTGTGG - Intronic
1091319696 11:134640781-134640803 CACAGGGACAGGCAGGAAGGAGG + Intergenic
1091334401 11:134755524-134755546 CACAGGGACAGGATGGAGTGGGG + Intergenic
1091872468 12:3906052-3906074 GGCAGCGATGGGAAGGAGTGTGG - Intergenic
1092631280 12:10380722-10380744 CTCAGGGATCGTGAGGAATGTGG - Intronic
1093619056 12:21265328-21265350 CACAGTGAAGGGATGGAAGGTGG + Exonic
1094078129 12:26500927-26500949 TAAGGGGATGGGAATGAATGTGG - Intronic
1094672897 12:32588078-32588100 CACAGGGATGGAGGGGAATGGGG + Intronic
1095246921 12:39933805-39933827 CACTGAGATGGGTAAGAATGGGG + Intronic
1095452359 12:42346226-42346248 CACGGGTAGGGGAAGAAATGGGG - Intronic
1096738960 12:53677553-53677575 GAAAGGGAGGGGAAGGAGTGGGG + Intergenic
1096776719 12:53968865-53968887 GAGAGGGGTGGGAAGGCATGGGG - Intergenic
1096840839 12:54378638-54378660 CTCAGGGATGGGAAGACCTGAGG + Intronic
1097249390 12:57624245-57624267 CACAGGCAAGGGAAAGGATGGGG + Intronic
1097478365 12:60087693-60087715 CACAGGGCTGGGAAGGCCTCAGG - Intergenic
1097725042 12:63065842-63065864 CACAAGAATGAGAAGAAATGAGG + Intergenic
1097827386 12:64188168-64188190 CAGAGGCATGGGAAGAAAGGTGG + Intronic
1098222201 12:68282078-68282100 CATAGTAATGGGAAGTAATGAGG + Intronic
1098871962 12:75826501-75826523 CTCTGGGATGGGTAGGAAGGAGG - Intergenic
1099341557 12:81442925-81442947 CATAGGGATGAGGAGGGATGTGG - Intronic
1099609611 12:84850916-84850938 CACAGGGCTGGGAAGGCCTCAGG - Intergenic
1100924893 12:99533960-99533982 CACAGGGATTGGAAGGTTTTGGG - Intronic
1100958378 12:99935261-99935283 CACAAAGTTGGGAAGGGATGGGG + Intronic
1101119794 12:101566902-101566924 CACAGAGCTGGGAAGTAAGGTGG - Intergenic
1101436677 12:104670146-104670168 CACAGGGAGAGGGAGGAAGGGGG + Intronic
1101797790 12:107991849-107991871 CACAGGGAAAGGAAGAATTGGGG + Intergenic
1101881649 12:108629946-108629968 CACAGGGGTGAGGAGGAATGAGG - Intronic
1103341426 12:120223123-120223145 CAGAGGGTAGGGAAGGGATGTGG + Intronic
1103859725 12:124002702-124002724 GACAGAGATGGGGAAGAATGAGG + Intronic
1103889385 12:124227378-124227400 CTGGGGGAAGGGAAGGAATGAGG + Intronic
1104159978 12:126168664-126168686 CTGAGAGAAGGGAAGGAATGAGG + Intergenic
1104212170 12:126699273-126699295 CCAAGAGATGGCAAGGAATGAGG + Intergenic
1104421586 12:128640461-128640483 CCCAGGGCTGGGAGGGACTGGGG + Intronic
1104460426 12:128951599-128951621 CACAGGCTTGGGACGGAAAGCGG - Intronic
1104615630 12:130265938-130265960 CACAGGGCTGGTAAGAAAAGCGG - Intergenic
1104956757 12:132470538-132470560 CACAGGGAGGGAAAGGGAAGGGG + Intergenic
1104956822 12:132470805-132470827 CACAGGGAGGGAAAGGGAAGGGG + Intergenic
1105303758 13:19155501-19155523 GTCAGGGATGGGAAGGGCTGTGG + Intergenic
1106056209 13:26239891-26239913 CAAAGGGAGGGGAAGAAAAGTGG - Intergenic
1106106400 13:26737098-26737120 CACAGGGGTGGGCAGAGATGAGG + Intergenic
1106503561 13:30352420-30352442 CATAGGGATGGAAATAAATGTGG - Intergenic
1108036791 13:46298333-46298355 GGCAGGGAGGGGAAGGAAGGGGG + Intergenic
1108219098 13:48215349-48215371 CACAGGGATGGGGAGGGCTCAGG - Intergenic
1111421503 13:88017954-88017976 CACAGGGTTGGGAAGGTTTCAGG - Intergenic
1112560828 13:100512374-100512396 GACAGTAATGGGAGGGAATGAGG - Intronic
1113923287 13:113926595-113926617 CAGAGGATGGGGAAGGAATGAGG + Intergenic
1113959175 13:114116342-114116364 CATAGGGAGGGGTAGGGATGGGG - Intronic
1114742615 14:25113689-25113711 CACAGGAATTGGAGGGAATGGGG + Intergenic
1115786935 14:36837105-36837127 CAGAGTGATGGGAAGGTGTGTGG + Intronic
1116441140 14:44954504-44954526 TACAGCGATGAAAAGGAATGAGG + Intronic
1116900076 14:50353467-50353489 CACAAAGATGGGAAGGGCTGGGG + Intronic
1116971302 14:51068905-51068927 AAGAGGGTTGGGATGGAATGAGG + Intronic
1117051017 14:51859874-51859896 CTCATAGATGGGAAGGAATGAGG - Intronic
1117224497 14:53640645-53640667 GACAGAGAAGCGAAGGAATGAGG - Intergenic
1117694737 14:58349012-58349034 CTAAGGGTTGGGGAGGAATGAGG - Intronic
1118905586 14:70021001-70021023 CACTGAGACGGGAAGGGATGAGG - Intronic
1118994895 14:70826808-70826830 CCCAGGAATGGGAATGAAGGTGG + Intergenic
1119062038 14:71484992-71485014 CACAGGGCTGGGATGGAGTAAGG - Intronic
1119669036 14:76504967-76504989 CACTGAGATGGGAAAGACTGAGG + Intergenic
1119673843 14:76539191-76539213 CAAAGGGAAGGGAAGGGAGGGGG - Intergenic
1119744355 14:77033607-77033629 AACAGGGAGGGGAAGAAAGGCGG + Intergenic
1120762727 14:88300232-88300254 CTCAGGGAAGGGAATGTATGTGG - Intronic
1121414775 14:93771836-93771858 CCCAGGGAAGGAAAGGAAAGGGG + Intronic
1122090890 14:99339458-99339480 CACAGGGACGGGAACATATGAGG + Intergenic
1122171604 14:99880505-99880527 CACAGGGAAGGAAAGGAGTAGGG + Intronic
1122352874 14:101106915-101106937 CACAGGGATGGGCAGGCCTCAGG + Intergenic
1122745829 14:103896766-103896788 CACATGGCGGGGAAGGAAGGCGG - Intergenic
1122809854 14:104282501-104282523 CCCTGGGATGGGAAGAAAAGGGG - Intergenic
1123011191 14:105350391-105350413 GACAGGCAGAGGAAGGAATGGGG - Intronic
1123043476 14:105499993-105500015 CACCGGAATGGGAAGGCAGGCGG - Intergenic
1123684833 15:22789444-22789466 CACAGGGATGGAAAGGACCTTGG - Intronic
1124460255 15:29883342-29883364 CACAGGGAATGCAGGGAATGTGG + Intronic
1124943561 15:34241320-34241342 CACAGAGCTGAGAAAGAATGGGG - Exonic
1127342989 15:58066183-58066205 GACGGGGATGGGAGGGAACGTGG - Exonic
1127374487 15:58370482-58370504 AAAAGGGAGGGTAAGGAATGGGG + Intronic
1128161257 15:65423946-65423968 CACAGGGAAGGGAAGAACTATGG - Intergenic
1128642651 15:69351099-69351121 CACAGGTTAGGGAAGCAATGTGG - Intronic
1129024086 15:72552751-72552773 AACAGGGATGGGAATGAGGGAGG + Intronic
1129156489 15:73721552-73721574 CACAGGGCTGGGTGGGGATGGGG - Intergenic
1129654599 15:77515785-77515807 CAGAGGTTTGAGAAGGAATGTGG + Intergenic
1129787695 15:78320429-78320451 CAGATGGAGTGGAAGGAATGGGG - Intergenic
1130249964 15:82293539-82293561 CACAGTGCTGGGAATGAATAGGG + Intergenic
1130744876 15:86640417-86640439 CACAAGGATGGACAGAAATGTGG - Intronic
1131114219 15:89784260-89784282 CACAGGGATGGGCTGGGCTGAGG - Intergenic
1131400443 15:92121214-92121236 CTCAGGCAGGGTAAGGAATGTGG + Intronic
1131458833 15:92604327-92604349 CATAGGGACAGGAAGGGATGTGG - Intergenic
1131535155 15:93231347-93231369 CAGAGGGATGAAAAGGAAGGAGG - Intergenic
1132093273 15:98962694-98962716 TGCAGGGCTTGGAAGGAATGTGG + Exonic
1132144152 15:99417023-99417045 CTCAGGGCTGGGCAGGGATGGGG - Intergenic
1132148316 15:99441804-99441826 CTTGGGGATGGGAAAGAATGAGG - Intergenic
1132359594 15:101201482-101201504 CAGAAGGATGGGAAGGAGTTAGG - Intronic
1132976561 16:2714035-2714057 GACAGGGCTGGGAAAGAATGGGG - Intronic
1133392746 16:5422737-5422759 GAAAGGGATGGGGAGGAAAGAGG + Intergenic
1133430759 16:5735047-5735069 CACAGTGGTAGGAAGGAATGGGG + Intergenic
1133473420 16:6097313-6097335 CACAGGGGTAGGAAGAAAGGGGG - Intronic
1133613573 16:7455318-7455340 CACAAGGATGAGAAAGAATGAGG - Intronic
1133889862 16:9868698-9868720 CAGAGGGAAGGGAAGGCCTGGGG - Intronic
1134041968 16:11075960-11075982 CACAGGGATGAGAAGAAACAAGG - Intronic
1134365351 16:13572083-13572105 CATAGGCATGGGAAGGGATGCGG - Intergenic
1135396096 16:22132756-22132778 CACAAGGATGGAAAGAGATGAGG - Intronic
1136078275 16:27831900-27831922 CACAGGGAGGGAAGGCAATGGGG - Intronic
1136748361 16:32612210-32612232 CTCTGGGATGACAAGGAATGAGG - Intergenic
1137444770 16:48525017-48525039 CAGAGGGAGGGGCAGGAGTGGGG - Intergenic
1137608178 16:49800867-49800889 AACAGGGAAGGGAAGGAAAAAGG + Intronic
1137745209 16:50815544-50815566 GACAGGGCAGGGAGGGAATGTGG - Intergenic
1137882193 16:52061559-52061581 CACAGGGAGGGGATGGCAGGGGG + Intronic
1138186205 16:54979489-54979511 CACAGGGAGGGGGAGGAGCGGGG + Intergenic
1138200072 16:55081916-55081938 CAGAGGGAAGGGAAGGGAAGGGG - Intergenic
1138311203 16:56025264-56025286 TATATGGATGGGAAGGACTGAGG - Intergenic
1139207043 16:65039064-65039086 CACAGAGGTGGGAAATAATGGGG - Intronic
1139372860 16:66479457-66479479 GACAGGGCTGGGTAGGCATGAGG + Intronic
1140221446 16:73047528-73047550 CAGAGGGAAGGGAAGGAAGGAGG + Intronic
1140332357 16:74070274-74070296 GCAAGGGATGGGAAGGAAGGTGG + Intergenic
1141950840 16:87338488-87338510 CACAGGGGTGGGAAGGGACATGG + Intronic
1203050496 16_KI270728v1_random:871415-871437 CTCTGGGATGACAAGGAATGAGG - Intergenic
1203141647 16_KI270728v1_random:1771229-1771251 CAGGAGGATGGGGAGGAATGAGG + Intergenic
1143119480 17:4598030-4598052 CAAAGGCGTGGGCAGGAATGAGG + Intronic
1143586127 17:7851422-7851444 CAGAGGGAGGGGAAGGAAGCAGG - Intronic
1143672519 17:8406275-8406297 CAGAGGGAGGGGATGGGATGGGG - Intergenic
1144887240 17:18471662-18471684 CAGAGGGGTGGCAGGGAATGAGG - Intergenic
1144954546 17:19012520-19012542 CCCAGGGATGACAAGGGATGAGG + Intronic
1145144976 17:20472633-20472655 CAGAGGGGTGGCAGGGAATGAGG + Intergenic
1146162423 17:30567086-30567108 CAGAGGGATGGGATGGAGGGAGG - Intergenic
1146312389 17:31779241-31779263 CACAGTGATGTGAGGGAGTGAGG - Intergenic
1148248188 17:46049702-46049724 TACAGGTATGGGAAGGGAGGTGG + Intronic
1148294214 17:46486151-46486173 GATAGGGAGAGGAAGGAATGGGG - Intergenic
1148316397 17:46703865-46703887 GATAGGGAGAGGAAGGAATGGGG - Intronic
1148686751 17:49505406-49505428 TACAGGGAGGGGAAGGAACAGGG - Intronic
1148766809 17:50044330-50044352 CACAGGGATGGGGAGGCAGGGGG - Intergenic
1149833334 17:59890728-59890750 TAGTGAGATGGGAAGGAATGGGG + Intronic
1150156762 17:62860473-62860495 AACTTGGATGGGAAGGAGTGAGG - Intergenic
1151275998 17:73034757-73034779 CAGAGGGATGGAAGGAAATGTGG - Intronic
1151465602 17:74282936-74282958 CCCGGGGATGAGAAGGACTGTGG + Intronic
1151560540 17:74867351-74867373 CTCAGAGATGGGGAGAAATGTGG + Intronic
1152301778 17:79499056-79499078 TACATGGATGGGTAGGAATGTGG - Intronic
1152366082 17:79857264-79857286 CACAGGGACAGGAAGAAACGAGG - Intergenic
1152637921 17:81437783-81437805 CACAGGGTGGGGAAGGGACGGGG - Intronic
1153033019 18:732686-732708 CACAGTAAAGGGAAGGAGTGGGG + Intronic
1153260327 18:3217405-3217427 AACTGAGATGGGGAGGAATGTGG + Intronic
1153330377 18:3867466-3867488 CACGGGGTGGGGAAGGAAGGAGG + Intronic
1155131910 18:22944084-22944106 CACACCCATCGGAAGGAATGAGG - Intronic
1156454461 18:37285193-37285215 CAGAGGGATGGGCAGGACTGGGG - Intronic
1156491729 18:37500330-37500352 TCCAGGGATGGGAAGGAGTAGGG + Intronic
1156518738 18:37703361-37703383 GCCAGGGGTGGCAAGGAATGGGG - Intergenic
1156723509 18:40099469-40099491 CACAGGGATCAGAGGGAAGGTGG + Intergenic
1156783488 18:40880852-40880874 CAAAGGGATGGGACTGCATGAGG + Intergenic
1157190937 18:45581046-45581068 CATGGGGAAGGGAGGGAATGTGG + Intronic
1157310169 18:46546803-46546825 CACAGGGGAGGGAAGGAAGATGG + Intronic
1157399459 18:47375239-47375261 AACAGAGAAGGGAAGGAATATGG + Intergenic
1157970078 18:52257144-52257166 CACAAGGATGGGAAAGAAATTGG + Intergenic
1158120498 18:54043038-54043060 CAAAGGGGCAGGAAGGAATGAGG - Intergenic
1159140701 18:64390430-64390452 CACAAGGAAGTAAAGGAATGGGG + Intergenic
1159812570 18:73034113-73034135 CACAAGGATGTGAAGCAATGGGG + Intergenic
1160258378 18:77266628-77266650 CACAGGGATGGGGAGGCCTCAGG + Intronic
1161642932 19:5435672-5435694 CAGAGGGTGGGGAAGGGATGGGG - Intergenic
1161807609 19:6454103-6454125 CACAGGGATGGGTAGGACCATGG + Intronic
1162165138 19:8747533-8747555 TACTGGAATGGGTAGGAATGGGG - Intergenic
1162166203 19:8754987-8755009 TACTGGAATGGGTAGGAATGGGG - Intergenic
1162167269 19:8762443-8762465 TACTGGAATGGGTAGGAATGGGG - Intergenic
1162168213 19:8768743-8768765 TACTGGAATGGGTAGGAATGGGG - Intergenic
1162169278 19:8776196-8776218 TACTGGAATGGGTAGGAATGGGG - Intergenic
1162169957 19:8781508-8781530 TACTGGAATGGGTAGGAATGGGG - Intergenic
1163018284 19:14470014-14470036 CAAAGGAGGGGGAAGGAATGGGG + Intronic
1163085363 19:14975821-14975843 CAAAGGGAAGGGAAGGGAAGGGG + Intronic
1163302785 19:16458190-16458212 CACAGCGATGAGGAGGAAGGTGG - Intronic
1163476087 19:17526986-17527008 CAGGGGGATGGGCAGGGATGCGG - Intronic
1163496417 19:17648710-17648732 CTCAGTGATGGGGCGGAATGGGG - Intronic
1163726224 19:18924597-18924619 CACAGGGTTGGGAAGAAAATTGG - Intronic
1164471927 19:28543515-28543537 CCCGGGGTTGGGAAGGAAGGGGG + Intergenic
1165321104 19:35085658-35085680 CCCAGGGGTGGGAAGGCATTTGG - Intergenic
1165334145 19:35157210-35157232 CACAGGGATGGGCGGGGAGGGGG + Intronic
1165404572 19:35621840-35621862 CACAGGGCAGGGATGGGATGGGG + Intronic
1165725898 19:38112748-38112770 AAGAGGGATGGGAAGGGAGGGGG - Intronic
1166300470 19:41909621-41909643 CACAGGGCAAGGAAGGGATGAGG + Intronic
1166347669 19:42176636-42176658 GGCAGGGATGGAAAGAAATGGGG - Intronic
1167390028 19:49188899-49188921 GACAGGGATGGGAAGGAGTAGGG - Intronic
1167682755 19:50934895-50934917 CACAGGGATGCCAAGGCAGGAGG + Intergenic
925359707 2:3268745-3268767 CACAGGGGTGGGAAGTAAGCCGG + Intronic
925413411 2:3653291-3653313 CACAGGGGTGTGAGGGACTGTGG + Intergenic
925749107 2:7071473-7071495 CACACGGCTGGGAAGTAGTGAGG - Intergenic
925789945 2:7474164-7474186 CACAGTGGAGGGAAGGAATTGGG - Intergenic
925917080 2:8614514-8614536 CTCAGGGAGGGGAAGGGATGTGG - Intergenic
926877772 2:17502609-17502631 GATAGGAATGGGAAGGAATGTGG + Intergenic
927188621 2:20500336-20500358 CCCAGGGGCAGGAAGGAATGGGG + Intergenic
927609198 2:24520597-24520619 CACAGGGAAGTGTGGGAATGAGG + Intronic
928139669 2:28717707-28717729 TCCAGGGACAGGAAGGAATGGGG + Intergenic
928216153 2:29363062-29363084 CAAAGGGAAGGGAAGGAAAATGG - Intronic
928403119 2:30993521-30993543 GCCAGCGATGGGAAGGAAGGAGG + Intronic
929549532 2:42880585-42880607 GACAGGGATGGGGAGGTATAAGG - Intergenic
929590512 2:43142816-43142838 CATGGGGATGGCAAGGAAGGGGG - Intergenic
929841131 2:45464559-45464581 CACAAAGAAGGGAAAGAATGTGG + Intronic
929918100 2:46153000-46153022 CAGAGGGGAGAGAAGGAATGAGG - Intronic
930105045 2:47632914-47632936 CACAGGGAGGGGAAGGCATGTGG - Intergenic
930775372 2:55165439-55165461 CAAAGGGTTGGGTGGGAATGAGG + Intergenic
931007239 2:57865739-57865761 CAAAGGGTTTGGAAGGAGTGGGG - Intergenic
931529971 2:63202842-63202864 CACAGACAAGGGAAGGAAGGAGG - Intronic
931586248 2:63832495-63832517 CACAGGGATGGGAAGAATTGTGG + Intergenic
932745822 2:74332811-74332833 CACAGGGAAGGGCAGGGATGAGG - Intronic
933048825 2:77575566-77575588 CTTAGGGCTGGGGAGGAATGGGG + Intronic
933621094 2:84542393-84542415 CACAGGGCTGGTGAGGAATATGG - Intronic
935198689 2:100836799-100836821 TACAGGGTTTGGGAGGAATGGGG + Intronic
935284194 2:101549353-101549375 CACAGGGAGGGGAAGCCAGGCGG - Intergenic
935474913 2:103507213-103507235 CACAGGGCTGGGGAGGCATCAGG - Intergenic
935648728 2:105363843-105363865 CACAGGGCTGGTAAGGAGTAGGG - Intronic
935683757 2:105664854-105664876 CACATCTATGGGAAAGAATGAGG - Intergenic
936061874 2:109300143-109300165 CACAGGGATGGGAAGAATAATGG + Intronic
936432362 2:112475364-112475386 GTCAGGGATGGGAAGAAACGGGG + Intergenic
936561611 2:113543418-113543440 GAGAGGGTTGGGAAGGAAGGAGG - Intergenic
937921713 2:127136127-127136149 CAGAAGGATGGGAAGGGCTGGGG + Intergenic
937942950 2:127302407-127302429 GGCAGGGATGGGAAGGAAGAAGG - Exonic
938657095 2:133445711-133445733 CACAGGGAGAGTAAGGAAGGGGG + Intronic
938762886 2:134441608-134441630 CACATGGATGGGCTGGATTGGGG - Intronic
938841348 2:135167744-135167766 TAGAGGGATGGGAAGGAACAAGG - Intronic
939251553 2:139687245-139687267 GACAGGGGCTGGAAGGAATGGGG - Intergenic
939826493 2:147022412-147022434 CACAGGGATGGGGAGGCCTCAGG + Intergenic
940343183 2:152602191-152602213 CACAGGGATGGGCAGATAGGTGG + Intronic
940443034 2:153742918-153742940 CCAAGGGAAGGGAAGGAAAGGGG + Intergenic
941158595 2:162008983-162009005 AAGAGGGAAGGGAAGGAAGGAGG - Intronic
941857189 2:170242976-170242998 GACAGGGATGAGGAGCAATGAGG + Intronic
943493852 2:188593144-188593166 TACAGGAAAGGGTAGGAATGGGG + Intronic
943702044 2:190997077-190997099 CAGGGAGATGGGAAGGAAAGTGG - Intronic
944325807 2:198402247-198402269 AGCAGGGAAGGGAAGGAATAAGG - Intronic
944634398 2:201660796-201660818 CCCAGGAAGGGGAAGGAATGAGG - Intronic
945514294 2:210743605-210743627 CACTGGGCTGGGAAGGTAGGTGG + Intergenic
947838106 2:233189527-233189549 CCTAGGGATGGGAAGGAACGGGG + Intronic
948327713 2:237139933-237139955 CACAAGCACAGGAAGGAATGGGG - Intergenic
1168818700 20:759120-759142 AACAGGGATGGGAAGCATGGTGG + Intergenic
1169123681 20:3112119-3112141 TACAGGGAAGGGAAGGAGGGAGG + Intronic
1169262948 20:4150781-4150803 CACTGAGATGGGAAGGCCTGGGG - Intronic
1169507094 20:6223000-6223022 CACAGTGAAGGGCAGGGATGAGG - Intergenic
1169524492 20:6408654-6408676 CAGAAAGATGGGAAGGAATGAGG - Intergenic
1169808613 20:9585198-9585220 TTCAGAGATGGGAAGGCATGGGG - Intronic
1169981718 20:11392363-11392385 CACAGCGATGTGAAGGACAGAGG + Intergenic
1170296535 20:14832378-14832400 GAGAGGGATGGGAAGGAGGGAGG + Intronic
1170354838 20:15480628-15480650 CATAGGGGTGGGAAGGAGTCAGG + Intronic
1170897443 20:20428685-20428707 CACAATAATGGGAAGAAATGAGG - Intronic
1171249750 20:23638378-23638400 CGGATGGATGGGGAGGAATGGGG - Intronic
1171493551 20:25538631-25538653 CACAGTGATGGGTAGGACTGGGG + Intronic
1172013592 20:31860729-31860751 CACAGGGAAGGGAAGGGAGTCGG + Intronic
1172992761 20:39048425-39048447 CACAGGGAAGGGAGGGGAAGTGG - Intergenic
1173014729 20:39214877-39214899 CTCAGGGATTGGAAGGAATCAGG + Intergenic
1173234091 20:41228000-41228022 CAGAAGGAGAGGAAGGAATGGGG - Intronic
1173864466 20:46305493-46305515 CTCAGCTATGGGGAGGAATGAGG + Intronic
1174088321 20:48026374-48026396 CAAAGGGAAGGGAAGGAAAGGGG - Intergenic
1174118230 20:48242623-48242645 TACAGAGATGGGAAGGCAGGTGG - Intergenic
1174401106 20:50276455-50276477 GACAGGGATGGGTGGGAAAGAGG + Intergenic
1175131189 20:56790886-56790908 GCCAGAGGTGGGAAGGAATGTGG + Intergenic
1175156603 20:56975897-56975919 GACACAGATGGGGAGGAATGTGG + Intergenic
1175769005 20:61611203-61611225 CCCAGGGAGAGGAAGGAAAGGGG - Intronic
1175785390 20:61708652-61708674 CCCAAGGATGGGAAGGGGTGGGG - Intronic
1176244973 20:64093132-64093154 CACAGGGAGGGGAGGGGAGGGGG + Intronic
1177222783 21:18216695-18216717 CACATGGCTGGGGAGGAATCAGG + Intronic
1177789014 21:25701576-25701598 GACAGGGATGGGAAGGAGCAAGG + Intronic
1178338486 21:31765373-31765395 CACAGGGCTGGGAAGGCCTCAGG - Intergenic
1178678741 21:34653762-34653784 CACAGTGATGGGGAAAAATGAGG + Intergenic
1179058000 21:37953854-37953876 CACAGAGAGCTGAAGGAATGTGG + Intronic
1179116058 21:38493801-38493823 CACAGGACAGGGAAGGAAGGAGG - Intronic
1179446959 21:41438697-41438719 TACAGGGATGGAAGGGAATGTGG + Intronic
1179471383 21:41612995-41613017 CAGAGGGCAGGGAAGGAATCTGG - Intergenic
1179627949 21:42659176-42659198 CACACCAATGGGAAGGAGTGTGG - Intronic
1180015137 21:45076985-45077007 CCCAGGGATGGAGTGGAATGAGG - Intronic
1180059811 21:45379055-45379077 GACAGTGATGAGAAGGAATCAGG - Intergenic
1181271506 22:21661361-21661383 CACAGGGAGAGGCAGGAGTGGGG - Intronic
1181528784 22:23504306-23504328 CACCGGGATGGGATGATATGGGG - Intergenic
1181618576 22:24071875-24071897 CCCAGGGAGGGCAAGGAGTGGGG - Intronic
1181844333 22:25694582-25694604 CAGGGGGATGGGAAAGAAGGAGG - Intronic
1182070374 22:27459261-27459283 GACAGGGATGTGAAGGCAAGTGG - Intergenic
1182074007 22:27482615-27482637 CAGAGGGTTGGGAAGGAACCTGG + Intergenic
1182351795 22:29703794-29703816 CTCAGGGCAGGGAAGGTATGGGG + Intergenic
1182475792 22:30575599-30575621 CACGGCGATGGGAGGGAGTGAGG - Intergenic
1183378118 22:37476862-37476884 CCCAGGGGTGGGCAGGAAGGCGG - Intronic
1183391102 22:37546103-37546125 CAGCGGGACGGGAAGGAATCTGG + Intergenic
1183467267 22:37986023-37986045 CACAGGGAAGAGAAGGGAGGCGG - Intronic
1183511729 22:38239365-38239387 CACTGAAATGAGAAGGAATGAGG + Intronic
1183512892 22:38246142-38246164 CACAGGGACGGGAGGGCAGGTGG + Intronic
1184040383 22:41939593-41939615 TACAGGGATAGGAAGGAGGGAGG + Intronic
1184261757 22:43321369-43321391 CACAGTGAGGGGAAGCCATGGGG + Intronic
1184410875 22:44325641-44325663 CCCAGAGATGGGAAGCAAGGTGG - Intergenic
1184425328 22:44405925-44405947 CACAGGGAGGGGAAGGAATGAGG - Intergenic
1184821054 22:46909576-46909598 CACAGAGTTAGGAAGAAATGGGG - Intronic
1185032316 22:48450568-48450590 CACAGGGAGGGCAGTGAATGTGG - Intergenic
1185034502 22:48464936-48464958 CACCGGGCTGGGAAGGACCGGGG + Intergenic
1185072275 22:48662862-48662884 CATAGGGAGGGCAAGGATTGGGG - Intronic
1185081658 22:48712788-48712810 CACAGGAATGGGAAGGAGGGCGG - Intronic
1185107840 22:48884499-48884521 CACAGGGATGGGAATGCATGCGG + Intergenic
1185114670 22:48925314-48925336 CACAGGGATGGGGAGGCCTCAGG + Intergenic
1185116262 22:48940000-48940022 TACTGGGGAGGGAAGGAATGCGG + Intergenic
949900745 3:8812892-8812914 CACAGGGATGGGGAGGATCGCGG + Intronic
950038260 3:9902741-9902763 CACTTGGAGGGGAAGGAATGTGG + Intronic
950315322 3:11996821-11996843 CACATGAAGGGGAAGGGATGGGG + Intergenic
950654341 3:14427467-14427489 CAGAGGCCTGGGAAGGAAGGCGG - Intronic
950818149 3:15729261-15729283 CACAGAGGTGGGAAGGATTGTGG - Intronic
951010269 3:17669255-17669277 CACAGGGCTGGGAAGGCCTCAGG - Intronic
951040971 3:17988466-17988488 TGCAGGGATTGGAAGAAATGAGG + Intronic
951174025 3:19578276-19578298 CACATGGCTGGGAAGGCATCAGG + Intergenic
952746487 3:36786791-36786813 CCCTGAGATGGGAAGGAATGAGG - Intergenic
954295987 3:49674662-49674684 CACTGGGGTGGGAAGGAAGGGGG + Intronic
954302028 3:49705266-49705288 CACAGGGCTGGGAGGGCATGGGG - Intronic
954365482 3:50143867-50143889 CACAGGGTTGGGAGGACATGAGG + Intergenic
954365833 3:50145527-50145549 CCCAGGGAAGGGGAGGCATGTGG - Intergenic
954367278 3:50153309-50153331 TACTGGGTTGGGAAGGAAAGAGG - Intergenic
954611932 3:51949104-51949126 AACAGGGATTGGAGGGAAGGGGG - Intergenic
955058514 3:55476392-55476414 CAGGGGAATGGAAAGGAATGAGG + Intronic
956729818 3:72186400-72186422 CACTGTGATGGGAAAGAGTGAGG + Intergenic
956785297 3:72637355-72637377 CACATGGAGGGGAAGGAAGCTGG - Intergenic
956829671 3:73033694-73033716 GACAGGGATTGGAAGGAAGGAGG - Intronic
956853746 3:73255893-73255915 CTTAGGGATGGGAAAAAATGTGG + Intergenic
957001661 3:74893522-74893544 CACAGACATGGGAAGGACAGAGG + Intergenic
957064402 3:75509559-75509581 CACAGGGATTGGGAGGAGTGGGG + Intergenic
957471666 3:80667030-80667052 CACAGAAATGAGAAGGAATGAGG + Intergenic
958103809 3:89047898-89047920 AACAGTGATGGCATGGAATGTGG + Intergenic
959804863 3:110539342-110539364 CACAGGGATGGGGAGGCCTCAGG - Intergenic
960615208 3:119590279-119590301 GACATTGAGGGGAAGGAATGGGG + Intergenic
960708750 3:120506454-120506476 TCCAGGGGTGGGAAGGACTGTGG + Intergenic
960992872 3:123323188-123323210 AGCAGGGAGGGGAAGGAGTGTGG - Intronic
961288956 3:125829844-125829866 CACAGGGATTGGGAGGAGTGGGG - Intergenic
961412112 3:126730146-126730168 CATAGGGAAGGGAAGGGGTGGGG - Intronic
961597456 3:128029870-128029892 CAGAGGCTGGGGAAGGAATGGGG - Intergenic
961782889 3:129331479-129331501 CTCTGGGATGACAAGGAATGAGG + Intergenic
961898131 3:130186205-130186227 CACAGGGATTGGGAGGAGCGGGG + Intergenic
962487622 3:135860534-135860556 GACAAGGATGGGAGGGAATGGGG - Intergenic
963004735 3:140716535-140716557 CAATGGGGTGGGAAAGAATGTGG - Intergenic
964389745 3:156184848-156184870 CCCAGGGATGGGAGGGAAAATGG - Intronic
964477182 3:157107677-157107699 GAGAAGGCTGGGAAGGAATGGGG - Intergenic
965440765 3:168711033-168711055 GACAGTGATGGAAAGGAATAAGG - Intergenic
966333517 3:178841550-178841572 CACATGGATGGGAAGGCCTCAGG + Intronic
966624896 3:182005352-182005374 CACTGGAATTGGAAGAAATGAGG + Intergenic
966902029 3:184493491-184493513 CACAGGGTAGGAAAGGAAGGAGG + Intronic
966945029 3:184771641-184771663 CACAGGGCTGGGGAGGACAGGGG + Intergenic
967319052 3:188177786-188177808 CAAAGAGCTGGAAAGGAATGAGG + Intronic
967601932 3:191400584-191400606 GTCAGGGATGTGAGGGAATGAGG - Intergenic
967954707 3:194869280-194869302 CTGAGGGAGGGGAAGGAAAGGGG + Intergenic
967981424 3:195068005-195068027 AAGAGGGATGAGAAGAAATGGGG + Intergenic
967982062 3:195071677-195071699 CACAGGGTTGGGATGCAGTGTGG + Intronic
968817147 4:2828053-2828075 CACTGGGATGGGATGGGGTGGGG - Intronic
968974862 4:3816725-3816747 GAGAGGGATGGGAAGGCTTGTGG - Intergenic
969008258 4:4039293-4039315 CACAGGGATTGGGAGGAGCGGGG + Intergenic
969365781 4:6693604-6693626 CCCAGGGAGGGCCAGGAATGAGG + Exonic
969431117 4:7154883-7154905 CACTGGGGCTGGAAGGAATGGGG - Intergenic
969804668 4:9597744-9597766 CACAGGGATTGGGAGGAGTGGGG - Intergenic
969913059 4:10462460-10462482 CACAGGGATGTGACAGAATGAGG - Intergenic
970129493 4:12851454-12851476 CACAGTGAAGGGAACTAATGGGG + Intergenic
971028747 4:22613786-22613808 CACAGGGAAAGGAGGGAATATGG + Intergenic
971892168 4:32538760-32538782 AGCAGGAATGGGAAAGAATGGGG + Intergenic
972024796 4:34363121-34363143 CACAGGGATGAGAAGGATGTTGG - Intergenic
972982937 4:44727136-44727158 TACAGGAGTGGGAAGGAATTGGG + Intergenic
974068676 4:57104287-57104309 GACAGGGATAAGAAGGAATTGGG - Intronic
975673288 4:76802791-76802813 CACAGGGAGGGGAGGGGAAGTGG + Intergenic
975920357 4:79379778-79379800 TACAGGGATGTGAAGATATGGGG - Intergenic
976822035 4:89217356-89217378 CACAGGGGTGGTGAGAAATGAGG - Intergenic
976911607 4:90313724-90313746 CCCAGGGGTGGGAAGAGATGAGG + Intronic
977540273 4:98310361-98310383 CAGAGGGCTGAGAAGCAATGAGG + Intronic
978911032 4:114064260-114064282 CACAGGGAAGGTGAGGAATGTGG - Intergenic
980982974 4:139669832-139669854 CACAGGGGAGGGAGGAAATGGGG + Intronic
981117928 4:141013972-141013994 CTCAGGGGAGGGAGGGAATGGGG - Intronic
981417424 4:144509425-144509447 CCCAGGGATGGGATGGGATTGGG + Intergenic
981616707 4:146650288-146650310 AGCAGGGATGGGCAGGGATGAGG + Intergenic
982404589 4:155005782-155005804 CAAAGAGAAGGGGAGGAATGGGG + Intergenic
983649004 4:170020285-170020307 CTCAGGGCAGGGAAGGAAAGGGG - Intronic
984240154 4:177208706-177208728 CACAGCCATGAAAAGGAATGTGG - Intergenic
984328278 4:178281482-178281504 CTCAGAGTTGGGAAGGAATAGGG - Intergenic
984600832 4:181724925-181724947 GAAAGTGATGGGAAGGAAAGAGG + Intergenic
985643543 5:1074654-1074676 CACAGGGCCGAGAAGGAGTGGGG - Exonic
985695001 5:1335252-1335274 CACAGGGATGGGAAGGGGGATGG - Intronic
986051454 5:4094260-4094282 CTGATGGTTGGGAAGGAATGTGG + Intergenic
986376145 5:7133455-7133477 CACACATATGGGAAGGGATGCGG - Intergenic
986445284 5:7815964-7815986 CACAAGGAGAGGAAGGAAAGAGG - Intronic
986591453 5:9374989-9375011 AATGGCGATGGGAAGGAATGAGG - Intronic
986636210 5:9824533-9824555 CACAGGGATGGGTAAGGCTGTGG + Intergenic
987014200 5:13800771-13800793 CAAAGAGATTGGAAGGAATGTGG - Intronic
988167891 5:27617521-27617543 CCCAGGCATGGGAAGCATTGAGG - Intergenic
990050794 5:51497384-51497406 GAGAGGGATGGGCAGGAAGGTGG - Intergenic
990456522 5:55994623-55994645 AGCAGGAAGGGGAAGGAATGTGG + Intronic
990603294 5:57382647-57382669 CACAGGGTGGGAAAGAAATGGGG + Intergenic
990788768 5:59453260-59453282 CTCAGGGATGGGGAGGACTGAGG - Intronic
992375828 5:76186730-76186752 CACAGGGATGGGGAGGCCTCAGG + Intronic
992407149 5:76470371-76470393 CAGAGGGATGGGGATGACTGGGG + Intronic
994090315 5:95803967-95803989 CTCAGAGGTGGGAAGGAAAGTGG - Intronic
995625767 5:114075011-114075033 CACAGGGATGGGAAGGAAGAAGG - Intergenic
996173488 5:120325335-120325357 GACTGGGAAGGGAAGGAAAGAGG + Intergenic
996318019 5:122183097-122183119 CTCAGGGAGAGGAAGGAATCAGG - Intergenic
997164292 5:131642318-131642340 CTCAGGAATGGGAAGCAGTGGGG + Intronic
998134222 5:139666311-139666333 CACAGGGATGGGGGTGAAGGGGG - Intronic
998186017 5:139980754-139980776 GACAGGGAAGGGAAGGAAACTGG - Intronic
998510635 5:142711289-142711311 CACAGGGGTGGGAAGGCCTCAGG + Intergenic
998788000 5:145733350-145733372 AAAAGGGATGGGAATGGATGTGG + Intronic
999720365 5:154394830-154394852 CACAGGGAAAGGAAGAAATGAGG - Intronic
1000462982 5:161545812-161545834 CACAGAAATGGGGAGGACTGGGG - Intronic
1000506335 5:162124498-162124520 AAAAGGAATAGGAAGGAATGCGG + Intronic
1000909716 5:167007517-167007539 AGCAGGGATGGGAAAGATTGAGG - Intergenic
1000944171 5:167400247-167400269 GAGAGTGATGGGAAGGAGTGAGG + Intronic
1001049352 5:168402146-168402168 CAGAGGGAGGGGAAGAAAGGAGG - Intronic
1001544469 5:172562186-172562208 CACAGGGAGGGGAGGAATTGGGG + Intergenic
1001917409 5:175573462-175573484 CATAGGGAAAGGAGGGAATGGGG + Intergenic
1001934755 5:175696084-175696106 CACAGGGCTGGGATGTAATGAGG + Intergenic
1001963408 5:175894187-175894209 AACAGGGAAGGGAAGGTGTGAGG + Intergenic
1001990235 5:176110598-176110620 CTCTGGGATGAGAAGGAACGAGG - Intronic
1002088593 5:176791484-176791506 CCCTGGGCTGGGAAGGACTGGGG - Intergenic
1002181978 5:177435409-177435431 CACAGGGAGGGCAGGGACTGGGG - Intronic
1002226637 5:177727542-177727564 CTCTGGGATGAGAAGGAACGAGG + Intronic
1002267206 5:178043671-178043693 CTCTGGGATGAGAAGGAACGAGG - Intronic
1002432499 5:179211648-179211670 AACAGGGAGAGGATGGAATGAGG + Intronic
1002485723 5:179534915-179534937 AAAAGGGAAGGGAAGGAATTGGG + Intergenic
1002607233 5:180390549-180390571 GCCAGGGATGGGCAGGAAGGAGG - Intergenic
1002643746 5:180642936-180642958 CGCAGGGGTGTGAAGGCATGTGG - Intronic
1002692750 5:181061797-181061819 CACCAGGATGGGAACGGATGGGG + Intergenic
1002955648 6:1860849-1860871 CACACTGATGGGAAGGAGAGAGG + Intronic
1003129780 6:3386061-3386083 CACAGGAATGGGCATGAATGGGG - Intronic
1003470060 6:6421186-6421208 CACAGGTTGGGGAAGAAATGTGG + Intergenic
1003673070 6:8177933-8177955 TACAGACATGGGAAGGAAGGGGG - Intergenic
1004008261 6:11656799-11656821 CAAAGGGATGGGAAGAGGTGAGG + Intergenic
1004271380 6:14199120-14199142 CACATGGCTGGGATAGAATGAGG + Intergenic
1005401459 6:25438673-25438695 AACAAAGATGGGAAGGGATGAGG + Intronic
1005500964 6:26428880-26428902 CACAGGGATAGCAGGGAATTGGG + Intergenic
1005582507 6:27248143-27248165 CAGAGGGATGGGGAGAACTGAGG - Intronic
1005849640 6:29811970-29811992 GAAAGGGCTGGGAAGGGATGGGG - Intergenic
1006290415 6:33131152-33131174 ACCAGGGATGGAAAGGGATGGGG - Intergenic
1006971565 6:38050633-38050655 CACATGGATGGGAAGGCCTCAGG - Intronic
1007488684 6:42200783-42200805 CATAGGCATGGGGAGGAGTGTGG - Intergenic
1007698353 6:43748052-43748074 CCCAGGGATGGGGAGGAGTTGGG + Intergenic
1007782255 6:44261168-44261190 CAGAGTGAGAGGAAGGAATGTGG - Intronic
1008441849 6:51540732-51540754 CACAGGGATGTGATGGAATATGG - Intergenic
1008806154 6:55431140-55431162 CACAGTCAAGGGAAAGAATGTGG + Intergenic
1009436220 6:63621260-63621282 CACAGGGAGGGAGAGGTATGGGG + Intergenic
1010525203 6:76893360-76893382 CACAGGGATGGGGAGGCCTCAGG + Intergenic
1011101572 6:83728169-83728191 CCCTGGGAAGGGAAGGAAAGAGG + Intergenic
1012054784 6:94392724-94392746 CAGAGAGAGGGGAAGGAGTGTGG - Intergenic
1012126113 6:95429470-95429492 CACAGGGATGAGAAGGCCTCAGG - Intergenic
1012396604 6:98805142-98805164 CACGGGGAAAGGAAGGAAAGTGG - Intergenic
1012843893 6:104365326-104365348 TACAGGGAAGAGAAAGAATGGGG - Intergenic
1013109518 6:107053907-107053929 TCCAGAGATGGGAAGGAAGGGGG - Intergenic
1013128043 6:107204290-107204312 CTCAGCCATGGAAAGGAATGAGG - Intronic
1014006009 6:116418989-116419011 CACAGGGAGGGAAAGGAGAGGGG - Intronic
1014082422 6:117302971-117302993 CCCAGGGCTTGGAAGGAATGAGG + Intronic
1014719455 6:124898344-124898366 AAGTGGGATGGGAAGGAAGGTGG - Intergenic
1015089681 6:129340456-129340478 CAAAGGGATGGAAAATAATGTGG + Intronic
1017310963 6:152977107-152977129 CACAATGCTGGGAAGGAATATGG + Intronic
1017504013 6:155051034-155051056 CAAAGGGATTGGAAAGAAGGTGG + Intronic
1017642534 6:156508163-156508185 TGCAGGGAGGGCAAGGAATGGGG - Intergenic
1018050756 6:160006012-160006034 CACAGGGGTGGGGAGGTATGGGG - Intronic
1018634198 6:165846549-165846571 CACTGTGATGGGAAGGGCTGAGG - Intronic
1018735750 6:166686124-166686146 CACAGAGATGGGAAGAGATCAGG + Intronic
1018907655 6:168084830-168084852 CCCTGTGATGGGGAGGAATGAGG - Intergenic
1019160924 6:170066489-170066511 CAGAGGGATGGGATGGATGGAGG - Intergenic
1019908944 7:4086621-4086643 CAGAGAGATGAGAAGGAAGGAGG - Intronic
1020264155 7:6549272-6549294 CCCAGGGCTGGGATGGAAAGAGG - Intronic
1020328773 7:6997435-6997457 CACAGGGATTGGGAGGAGCGGGG + Intergenic
1020456238 7:8376408-8376430 CACAGGGATGCTGAGAAATGTGG + Intergenic
1021266644 7:18532421-18532443 TACAGGGATGGGAAGAGAAGTGG + Intronic
1021554988 7:21909957-21909979 CACAGGGGTGGGCAGGAGGGTGG + Intronic
1022533655 7:31082577-31082599 CCCAGGGAGGGGAAGGAACTTGG + Intronic
1023279105 7:38551702-38551724 CAAAGGGATGCTAAGGAAAGAGG + Intronic
1023746744 7:43329183-43329205 TACAGGGGTGGGAAGGGGTGAGG + Intronic
1023759413 7:43450073-43450095 CACAGAAATGGGAAAGAAGGAGG - Intronic
1024226522 7:47329867-47329889 CACAGGGATGGGCAGCAGGGAGG + Intronic
1024568524 7:50704925-50704947 CAGAGTGGTGGGAAGGAGTGTGG - Intronic
1024615535 7:51108644-51108666 AACAGGGAAGGGAACGAAGGTGG - Intronic
1025707887 7:63883848-63883870 CACAGTGATGGGCAGGGATGTGG + Intergenic
1026397346 7:69969022-69969044 CACAGGATTGGGAAAGATTGTGG + Intronic
1027230155 7:76267735-76267757 TACAGGGCTGGGGAGGAATCAGG + Intronic
1027542658 7:79487558-79487580 CACAGGGAGGGGATGCAATATGG + Intergenic
1027565820 7:79792321-79792343 CACAGGGATGAGACTGAAGGGGG - Intergenic
1028244698 7:88462934-88462956 CACAGGGAGGGGGAGGAAAGGGG - Intergenic
1028289170 7:89044285-89044307 CACAGGGCTGGGAAGGCCTCAGG - Intronic
1028506603 7:91578591-91578613 CACAGGGATTTGAAGGACTCTGG - Intergenic
1029097322 7:98098503-98098525 GACAGGGTGGGGAAGAAATGAGG - Intergenic
1030497459 7:110317312-110317334 CACTGGGATGAGAAAGGATGAGG + Intergenic
1031079964 7:117248863-117248885 CACAGTGTGTGGAAGGAATGAGG - Intergenic
1032203119 7:129837413-129837435 CAAAGGATTGGGAAGAAATGAGG + Intronic
1032562535 7:132907526-132907548 CACAGAGAAGGGAAGAAAGGAGG + Intronic
1032900223 7:136299085-136299107 CACTGTGATGGGATGGAATGTGG - Intergenic
1033419331 7:141192450-141192472 TTGAGAGATGGGAAGGAATGGGG + Intronic
1033537986 7:142329226-142329248 CTCTGTGATGGGAAGGAAGGAGG - Intergenic
1033551527 7:142452009-142452031 CTCTGTGATGGGAAGGAAGGAGG - Intergenic
1033741379 7:144278191-144278213 CACAGTTATGGGAAGAAATTGGG - Intergenic
1033752524 7:144371423-144371445 CACAGTTATGGGAAGAAATTGGG + Intronic
1033921475 7:146398280-146398302 CACAGGGCTAGGAAGGAATCAGG + Intronic
1034147940 7:148888712-148888734 CACAGGAAGGGGAAGAAAAGTGG + Intergenic
1034514172 7:151561089-151561111 CACAGGCATGAGAAGGAAAGAGG + Intronic
1035088122 7:156278935-156278957 CAGAGGAATGGGAAGGGTTGAGG + Intergenic
1035179204 7:157077149-157077171 CACAGGAATGAGAAGGAGAGAGG - Intergenic
1035246673 7:157566833-157566855 CACAGGGATGGGATGGAGCCTGG - Intronic
1036036677 8:5027819-5027841 CAAAGGAATGGGGAGAAATGTGG + Intergenic
1036089806 8:5653267-5653289 CAGAGGGATGGGAAGAAATGAGG + Intergenic
1036249595 8:7150338-7150360 CACAGGGATTGGGAGGAGCGGGG + Intergenic
1036392654 8:8337954-8337976 CACAGGGATGGCAGTGCATGTGG - Intronic
1037382581 8:18303073-18303095 GACAGGGAGAGGGAGGAATGTGG + Intergenic
1037913933 8:22760627-22760649 CAGAGGCCTGGGAAGGAAAGTGG + Intronic
1037919372 8:22793673-22793695 CACAGGGATGAGTAGCATTGTGG + Intronic
1037949564 8:23010039-23010061 TGCAGGGATGGGAGGGACTGAGG + Intronic
1039414809 8:37384856-37384878 CACAGGGTTCTGAGGGAATGGGG - Intergenic
1039485356 8:37905481-37905503 CAGTGGGAAGGGAAGGAAAGGGG - Intergenic
1040414723 8:47186220-47186242 CACAGGGATGGAAAAGAAACAGG - Intergenic
1040566285 8:48570812-48570834 CTCAGGGATGGGATGGGAGGTGG + Intergenic
1040580642 8:48696156-48696178 CACAGGGAGGGGAGGGCGTGGGG - Intergenic
1041727719 8:61033456-61033478 CACAGGGCTGGGGAGGAACAGGG + Intergenic
1042902898 8:73746551-73746573 GACAGGGAGGCGAAGGAATTGGG - Intronic
1043880177 8:85533327-85533349 CACAGCGATGCGGAGGAATGTGG - Intergenic
1043940301 8:86189235-86189257 CACAGGGCTGGGGAGGCATCAGG + Intergenic
1044055420 8:87563929-87563951 CACAGGGAAGGGGAGGAAATGGG - Intronic
1044288536 8:90439647-90439669 CACACCGATGGCAGGGAATGCGG + Intergenic
1044896936 8:96902572-96902594 CAGATGGATGGGATGGAAGGAGG - Intronic
1045407799 8:101884363-101884385 AATAGGGATAGGAAGGCATGCGG - Intronic
1045468053 8:102487427-102487449 CACCAGGAAGAGAAGGAATGGGG + Intergenic
1046886626 8:119374727-119374749 CTGAGGGATGGGAAGGAAGAAGG + Intergenic
1047894965 8:129356498-129356520 AACAGGGAGGGGAAGGAGGGAGG + Intergenic
1048394050 8:133996500-133996522 TCAAGGGATGGTAAGGAATGAGG + Intergenic
1048715027 8:137258974-137258996 CACAGTGATGGAAAAGAAGGTGG - Intergenic
1048991032 8:139760260-139760282 AACAGGGAAGGAAAGCAATGGGG + Intronic
1049230489 8:141479044-141479066 CACAAGGAGGGGAAGGCAAGGGG - Intergenic
1049270559 8:141693439-141693461 CTGAGGGATGGGCAGGAAGGAGG + Intergenic
1049891071 9:71900-71922 GAGAGGGTTGGGAAGGAAGGAGG + Intergenic
1049941581 9:551054-551076 AAAATGGATGGGAATGAATGAGG + Intronic
1050164387 9:2748601-2748623 CCCAGGGATGGGACCTAATGGGG + Intronic
1052636792 9:31116805-31116827 GACGGGGAAGGGAAGGAGTGGGG - Intergenic
1053506697 9:38649447-38649469 CAAAGGGATGTGAAGCAAAGGGG + Intergenic
1053514299 9:38716941-38716963 CACAGTGTGGGGCAGGAATGTGG - Intergenic
1053732512 9:41072955-41072977 GAGAGGGTTGGGAAGGAAGGAGG + Intergenic
1054695919 9:68358620-68358642 GAGAGGGTTGGGAAGGAAGGAGG - Intronic
1055081827 9:72275271-72275293 CACAAGAATGGGAAGGAGTGAGG + Intergenic
1055439727 9:76325959-76325981 CAAAGGGAGGGGAAGGAATGTGG + Intronic
1055492939 9:76825029-76825051 CACTGGGATGGGAAAGTTTGAGG - Intronic
1055773949 9:79747808-79747830 CCTAGGGATGGGGAGGAAGGAGG - Intergenic
1056133043 9:83604073-83604095 TAGAGGGATGGGAAGGAAAGGGG + Intergenic
1056246197 9:84697599-84697621 CACAGGGTTAGGAAGGAGAGAGG - Intronic
1057233859 9:93343082-93343104 TTCAGGGATGGGAAGGATTTGGG - Intronic
1057353129 9:94316754-94316776 CACATGGAGCGGAAGGGATGGGG + Intergenic
1058428971 9:104901237-104901259 CACTGTGATGGGACAGAATGAGG + Intronic
1058873018 9:109218692-109218714 CATCGGGATGGGAAGGAGTTAGG - Intronic
1059353535 9:113682940-113682962 CACTGGGAAGGGAGGGAAGGGGG + Intergenic
1059988351 9:119841241-119841263 TACAGGGAGGGGAAGGATTTGGG - Intergenic
1060186777 9:121568417-121568439 GTCAGGGATGTGTAGGAATGAGG + Intronic
1060325617 9:122611502-122611524 CACAGGGAAGGAATGGAACGTGG + Intergenic
1060624242 9:125095970-125095992 CACAGGGTTGGGAGGAAATGTGG - Intronic
1061220251 9:129246449-129246471 CCCCGGGATGGGAATGGATGGGG + Intergenic
1061227673 9:129290117-129290139 CAGAGGGCTGGGCAGGACTGGGG + Intergenic
1061807155 9:133142863-133142885 CACTGTAATTGGAAGGAATGTGG + Intronic
1062122549 9:134841580-134841602 CACAAGTATGGGAAGGGGTGGGG - Intronic
1062144036 9:134979018-134979040 GGCAGGGAGGGGAAGGAAGGAGG + Intergenic
1062441096 9:136570205-136570227 CACAGGCCTGGGAAGGCAGGAGG - Intergenic
1062731513 9:138112774-138112796 CACAGGGATGTGAGGGAGTGCGG + Intronic
1185463257 X:341925-341947 GAAAGGGCTGGAAAGGAATGCGG + Exonic
1185595553 X:1304497-1304519 CACAGGGATGGGAATGGAACAGG + Intronic
1185880521 X:3736032-3736054 CACACAGATGAGAAGGAATTAGG + Intergenic
1186036815 X:5431927-5431949 CACAGGGAAGGGTGGAAATGTGG - Intergenic
1186058237 X:5674528-5674550 GAAAGGGAAGGGAAGGAAAGAGG + Intergenic
1186346864 X:8702778-8702800 ACCAGTGATGGGAAGCAATGAGG + Intronic
1186690826 X:11973907-11973929 CCCAGGGATGAGATGGAGTGGGG + Intergenic
1186995607 X:15118253-15118275 TATAGGGATGGGACAGAATGTGG - Intergenic
1187670862 X:21664816-21664838 GACAGGGAAGGGAAGGGAAGGGG - Intergenic
1188907228 X:35803100-35803122 TACTGAGATGGGAAAGAATGTGG - Exonic
1189060154 X:37745108-37745130 CTCAGGGATAGGAAGGGCTGAGG + Intronic
1189723184 X:43941311-43941333 CAGATGGATGGGAAGGGATTGGG - Intergenic
1189954294 X:46262124-46262146 CAAAGGGAGGGGACGGAAAGAGG + Intergenic
1190071335 X:47282239-47282261 GACAGGGAAGGGAAGGGAAGGGG - Intergenic
1190363339 X:49669125-49669147 CACGGGGATGGGAAGGTAGGAGG - Intergenic
1190790567 X:53696246-53696268 CATCGGGAGGGGGAGGAATGAGG - Intergenic
1191662735 X:63667646-63667668 CTAAAGGATGGGAAGGAAAGGGG + Intronic
1191912101 X:66162429-66162451 GACAGGGAGGGGAAGGGATAAGG - Intergenic
1192113583 X:68389954-68389976 CACAGGGTTGGGAAGGCCTCAGG + Intronic
1192200709 X:69064880-69064902 GGGAGGGATGGAAAGGAATGTGG + Intergenic
1192261357 X:69507328-69507350 CAGAGGGTTGGGAAGGAAAAGGG + Intronic
1192596585 X:72414700-72414722 CAGAGAGGTGGGGAGGAATGGGG + Intronic
1192730079 X:73794254-73794276 AAAAGGGAAGGGAAGGAAAGGGG + Intergenic
1192738897 X:73874663-73874685 CACAGGCCAGGGAAGAAATGAGG + Intergenic
1194068386 X:89289251-89289273 CCAAGGGAAGGGAAGGAATTAGG + Intergenic
1194346654 X:92773615-92773637 CAAAGGGATGTGGAGGATTGCGG - Intergenic
1194573512 X:95582307-95582329 AAAAGGGATGGGAAGGAAAGAGG - Intergenic
1195062352 X:101208664-101208686 CACAGTGAGGGGGAGGTATGAGG - Intergenic
1195296260 X:103481135-103481157 CACAGGGGTGGGAAAGAGGGAGG - Intergenic
1196302800 X:114065721-114065743 CAAGGGGCAGGGAAGGAATGTGG + Intergenic
1197948005 X:131861665-131861687 CACAGAATTGGAAAGGAATGAGG + Intergenic
1198080623 X:133235997-133236019 CAAAGGGATGCGGAGGCATGGGG - Intergenic
1198411984 X:136379805-136379827 CACAGGGATCGGAAGAATTGTGG - Intronic
1199318167 X:146404711-146404733 CACAGGGATGGGGAGGCCTGAGG - Intergenic
1199404803 X:147444386-147444408 CAAAGGGATCCAAAGGAATGTGG - Intergenic
1199885840 X:152021366-152021388 CACAGGTATGGTAAGGATGGGGG + Intergenic
1200336142 X:155353454-155353476 CTCATGGAGGGGAAGGAAAGGGG + Intergenic
1200350328 X:155487773-155487795 CTCATGGAGGGGAAGGAAAGGGG - Intergenic
1200494064 Y:3859519-3859541 CATGGGGATGGGAAGGAACTTGG - Intergenic
1200654988 Y:5890259-5890281 CAAAGGGATGTGGAGGATTGCGG - Intergenic
1200722529 Y:6623420-6623442 CCAAGGGAAGGGAAGGAATTAGG + Intergenic
1200784634 Y:7249320-7249342 CACACAGATGAGAAGGAATTAGG - Intergenic
1201122892 Y:10886753-10886775 CAGAGGAGTGGAAAGGAATGGGG - Intergenic
1201909754 Y:19121902-19121924 AACAAGGAAGGGAAGGAAGGTGG - Intergenic