ID: 1063299714

View in Genome Browser
Species Human (GRCh38)
Location 10:4840607-4840629
Sequence GGATGTTCACAGGGATGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 310}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063299714_1063299722 6 Left 1063299714 10:4840607-4840629 CCTTCCCATCCCTGTGAACATCC 0: 1
1: 0
2: 1
3: 23
4: 310
Right 1063299722 10:4840636-4840658 TCAGCCACATGAAGCTGCTGTGG No data
1063299714_1063299723 7 Left 1063299714 10:4840607-4840629 CCTTCCCATCCCTGTGAACATCC 0: 1
1: 0
2: 1
3: 23
4: 310
Right 1063299723 10:4840637-4840659 CAGCCACATGAAGCTGCTGTGGG No data
1063299714_1063299726 15 Left 1063299714 10:4840607-4840629 CCTTCCCATCCCTGTGAACATCC 0: 1
1: 0
2: 1
3: 23
4: 310
Right 1063299726 10:4840645-4840667 TGAAGCTGCTGTGGGGTCCTTGG No data
1063299714_1063299724 8 Left 1063299714 10:4840607-4840629 CCTTCCCATCCCTGTGAACATCC 0: 1
1: 0
2: 1
3: 23
4: 310
Right 1063299724 10:4840638-4840660 AGCCACATGAAGCTGCTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063299714 Original CRISPR GGATGTTCACAGGGATGGGA AGG (reversed) Intronic
900001623 1:17802-17824 GGAGGCTGACTGGGATGGGATGG - Intergenic
900021344 1:188326-188348 GGAGGCTGACTGGGATGGGATGG - Intergenic
900141585 1:1141262-1141284 GGATGGGGACAGGGATGGGATGG - Intergenic
900403687 1:2483296-2483318 GGATGTGGCCAGAGATGGGACGG - Intronic
902449657 1:16488826-16488848 GGAGGCTCAGAAGGATGGGAGGG - Intergenic
903000845 1:20264553-20264575 GAATGTTGACAGAGATGGAAGGG - Intergenic
903056384 1:20639081-20639103 GGATGGGCCCAGGGATGGGCAGG - Intronic
905337575 1:37256106-37256128 GGATGTAGAGAGGGAGGGGAGGG - Intergenic
905936796 1:41830752-41830774 GGAAGTTCACTGGGGTGGGAGGG - Intronic
906516013 1:46439292-46439314 GGGTGCTCACAGAGAGGGGAGGG + Intergenic
907410659 1:54281274-54281296 GACTGTTGAAAGGGATGGGAAGG + Intronic
907577964 1:55545675-55545697 GGAGGTTGACAGGCATTGGAAGG + Intergenic
907953978 1:59210770-59210792 ACATGTACACAGGGAGGGGAAGG + Intergenic
908884696 1:68775157-68775179 GGATATTCAGAAGGGTGGGAGGG + Intergenic
912949567 1:114111542-114111564 GGATGGTCAGAGGGATGGAGAGG - Intronic
916797488 1:168180139-168180161 GCAGGTCCGCAGGGATGGGAAGG + Intronic
917155988 1:171999638-171999660 AAATATTCACAGGTATGGGATGG - Intronic
920637419 1:207717658-207717680 GGAAGTTCACAGCGAGGGGCAGG - Exonic
920755580 1:208727996-208728018 GGATGTTCACAGATGAGGGAAGG - Intergenic
920832174 1:209475390-209475412 GCATGCACACGGGGATGGGAGGG - Intergenic
1062892619 10:1075676-1075698 GGATGTTCACAGAGTGGGAATGG + Intronic
1062921580 10:1284408-1284430 GGATGCTCTCAGGGCTAGGAAGG + Intronic
1063299714 10:4840607-4840629 GGATGTTCACAGGGATGGGAAGG - Intronic
1063971316 10:11383031-11383053 GGGTGTTCACATAGATGGTAAGG - Intergenic
1065884978 10:30068879-30068901 GGATTTTCACAGGAAAGGCAAGG - Intronic
1065989760 10:30996902-30996924 GGAAATTCACAAAGATGGGAGGG + Intronic
1069610860 10:69771588-69771610 GGAAGTGCACAGGGAGGGGGGGG + Intergenic
1069857760 10:71451113-71451135 GGATGCCCTAAGGGATGGGAGGG - Intronic
1070827262 10:79398546-79398568 GGATGGTTCCAGAGATGGGAGGG + Intronic
1071397466 10:85238005-85238027 GGAGGTACACAGGGAGGGGGCGG + Intergenic
1072774545 10:98177536-98177558 GTATATTCCCAGGAATGGGATGG + Intronic
1074177993 10:111030239-111030261 GGGTTTTCACAGGCATAGGATGG + Intergenic
1074666873 10:115737629-115737651 GCAAGTTGAAAGGGATGGGAAGG + Intronic
1075071063 10:119320145-119320167 TGATGTATACAGGGATTGGAGGG + Intronic
1075245904 10:120822031-120822053 GGAAGGTCACAGATATGGGAAGG + Intergenic
1075255995 10:120926518-120926540 GGTGGTTCCCATGGATGGGATGG - Intergenic
1075474606 10:122723423-122723445 GGATTTTCACAGTGATGTGAGGG - Intergenic
1076041665 10:127254985-127255007 GGGTGGGCACAGGGATGGAAAGG + Intronic
1076110295 10:127854970-127854992 GGATGATCCCAGGGAAAGGAAGG + Intergenic
1076433991 10:130427131-130427153 GGCTCTCCACAGGAATGGGACGG + Intergenic
1076988932 11:259156-259178 GGGTGTGCACAGGGGTGGGGTGG - Intergenic
1080920957 11:36708824-36708846 GGCTGTAGACAGGGATGGGTGGG + Intergenic
1081676363 11:44972275-44972297 GGAGGGTCACAGGGTTGTGAAGG - Intergenic
1082167523 11:48965606-48965628 GGAGGTGCACAGGGCTGGGGGGG - Intergenic
1082609538 11:55280972-55280994 GGAGGTGCACAGGGCTGGGGGGG + Intergenic
1082850346 11:57758888-57758910 GTATGTTGACTGGGATGGTAGGG - Intronic
1083324733 11:61867469-61867491 GGATGGCCACAGGGGAGGGAGGG - Intergenic
1084004074 11:66314054-66314076 CGAAGCTTACAGGGATGGGAAGG + Intergenic
1084546458 11:69817458-69817480 GGCTGCTCACGGGGAGGGGAGGG - Intronic
1084695879 11:70755458-70755480 GGACGCTCACAGGGCAGGGATGG - Intronic
1085534633 11:77210688-77210710 GGAAGTTCAAGGGGGTGGGAGGG + Intronic
1085794991 11:79531180-79531202 GGTTGTTCATAGGGATGGTGGGG - Intergenic
1086098618 11:83074939-83074961 AGATTTCAACAGGGATGGGAAGG - Intergenic
1086850094 11:91798789-91798811 GGATGTGGCCAGGGGTGGGAAGG + Intergenic
1087660517 11:100982279-100982301 GCAAGTTCACTGGAATGGGAGGG + Intronic
1088050658 11:105510413-105510435 GGATGGACAGAAGGATGGGAAGG + Intergenic
1089126088 11:116177640-116177662 GGATGTGCTGGGGGATGGGAGGG + Intergenic
1089559460 11:119336520-119336542 GGATGGCCACAGGGGTAGGAGGG - Exonic
1092389519 12:8063425-8063447 GCATGTTCACAGTTAGGGGAAGG - Intronic
1093065375 12:14652799-14652821 AGAGCTTCACAGGGATGGGCAGG - Intronic
1095788415 12:46136663-46136685 GTATGATGACAGGGATGGGAGGG + Intergenic
1096626109 12:52897146-52897168 TGATGTCCACTGGGGTGGGAGGG - Intergenic
1096973111 12:55683122-55683144 GGATGTTCACAGCGATGTCCAGG + Intronic
1102037989 12:109783057-109783079 GGATGATGGCAGGGGTGGGAGGG - Intergenic
1103896894 12:124278968-124278990 GAGGTTTCACAGGGATGGGAGGG - Intronic
1104483164 12:129126522-129126544 GGATGTTCACAGCCATGAGTGGG - Intronic
1104813801 12:131634262-131634284 GGACCTGCACAGGGATGGGGAGG + Intergenic
1105829287 13:24149903-24149925 GGAGGAACACAGAGATGGGAAGG + Intronic
1106565364 13:30880163-30880185 GGATGCTCGCAGAGAGGGGAAGG - Intergenic
1107430034 13:40332293-40332315 GGATATGCAAAGGGTTGGGAAGG - Intergenic
1107750959 13:43565854-43565876 GGATGTTTACTAGGATGGCATGG - Intronic
1109351530 13:61188579-61188601 GGATGTGCTAAGGGATTGGAGGG + Intergenic
1109498571 13:63208851-63208873 GAATGTTCACGAGTATGGGAAGG + Intergenic
1109501396 13:63240460-63240482 GAGTGTACACTGGGATGGGATGG + Intergenic
1109504473 13:63282380-63282402 GGATGTTGAGAGGGAGGTGAGGG - Intergenic
1110509293 13:76329908-76329930 GTATGTTTTCAGGGATGGGGTGG - Intergenic
1112045136 13:95589129-95589151 GAGTATTGACAGGGATGGGAGGG - Intronic
1112370415 13:98788438-98788460 GGCTGTTCACAGAGATGCCAAGG - Intergenic
1113956248 13:114101231-114101253 GGAATTTCAGAGGGAAGGGAAGG + Intronic
1117105506 14:52394009-52394031 GCATGTTCCCCGGGTTGGGAAGG - Intergenic
1118018732 14:61689017-61689039 CAATGTTAAAAGGGATGGGATGG - Intergenic
1118704903 14:68471539-68471561 CTTTGTTCACTGGGATGGGAAGG + Intronic
1118741455 14:68742334-68742356 GGGTGTTGACAGGGAGGGGAGGG - Intergenic
1119391370 14:74293266-74293288 GGATGTCCACAGGGCTGGAGAGG + Intronic
1120083443 14:80241510-80241532 GGATATTCCAAGGGATTGGAAGG - Intronic
1120723344 14:87911133-87911155 GTATGTACCCAGGAATGGGATGG + Intronic
1121930378 14:97966674-97966696 GGAGGGTCACAGGGGTAGGAAGG + Intronic
1121996528 14:98607395-98607417 GGCTGGTCACAGGGGTGTGAGGG + Intergenic
1122710936 14:103657472-103657494 GAATGTTCGCACGGGTGGGAGGG + Intronic
1122943787 14:104995674-104995696 CGATGTGCACAGTGATGGGCAGG + Intronic
1123684834 15:22789451-22789473 GGTGGCTCACAGGGATGGAAAGG - Intronic
1124266500 15:28239834-28239856 GTATGATCACAGGGAGAGGAGGG + Intronic
1125742102 15:41972474-41972496 GGATGTTCAGCTGGATGGGGCGG - Exonic
1125794769 15:42396093-42396115 ACCTGTTCACAGGGCTGGGATGG - Intronic
1126001151 15:44211131-44211153 GGATGGTCCTAGGGATGGGTTGG - Intergenic
1126994342 15:54422747-54422769 GAGTGTTCTGAGGGATGGGATGG - Intronic
1127921955 15:63501482-63501504 GGATGTCCAGAGGGCTGGGTGGG + Intergenic
1128225719 15:65999968-65999990 GGCAGTGCACAGGGAAGGGAAGG + Intronic
1128328423 15:66740219-66740241 GGATGTCCACAGGACTGGGCAGG - Intronic
1128384505 15:67137992-67138014 GGGAGGTCACAGGGACGGGAGGG - Intronic
1129564112 15:76603537-76603559 GTATGTACCCAGTGATGGGATGG + Intronic
1130812292 15:87392646-87392668 TGCTGTGCAGAGGGATGGGAAGG - Intergenic
1130956340 15:88629915-88629937 GGAGGTTCACAGAAAAGGGATGG - Intronic
1131338839 15:91576792-91576814 GGATGCTCACAGGGGATGGAGGG - Intergenic
1132306353 15:100816677-100816699 CCATGTTCACAGAGATTGGAAGG + Intergenic
1132451886 15:101973138-101973160 GGAGGCTGACTGGGATGGGATGG + Intergenic
1133461900 16:5993966-5993988 GGATGTTGGCACGTATGGGACGG + Intergenic
1133976259 16:10601685-10601707 GGCTGTTGACAGGGGTGGGGTGG + Intergenic
1134180382 16:12043089-12043111 GGATGCGAACTGGGATGGGATGG + Intronic
1135970798 16:27070642-27070664 GGAGGTTCTTAGGGAAGGGAAGG - Intergenic
1136092609 16:27931290-27931312 GGATGTCCACAGGCATGGGCAGG - Intronic
1136277715 16:29188761-29188783 GGATGTGCACAGGAGTGGCACGG + Intergenic
1137480785 16:48850242-48850264 GGAGGAGCCCAGGGATGGGAGGG + Intergenic
1137692893 16:50441566-50441588 GGAGGTTGACAAGCATGGGAGGG + Intergenic
1138348380 16:56333657-56333679 GGATGTCCACAGGGCTGGAAAGG - Intronic
1138598763 16:58042951-58042973 GGATGTGCACATGGAAGCGAGGG + Intronic
1139513432 16:67440071-67440093 GAAAGTCCACAGGGATGGCAGGG + Intronic
1140123827 16:72104593-72104615 GGATGTCAACAGGGAAGGTACGG - Exonic
1140640580 16:76967255-76967277 TGATGTTCACATGAATAGGAAGG - Intergenic
1141395361 16:83699709-83699731 GGATGTTTAGAGGCATGGAAAGG + Intronic
1141651283 16:85394420-85394442 TGATGTTCACAGGAAGAGGACGG + Intergenic
1142082089 16:88154803-88154825 GGATGTGCACAGGAGTGGCACGG + Intergenic
1142129061 16:88424431-88424453 GGATCCTGGCAGGGATGGGAGGG + Intergenic
1142152697 16:88519697-88519719 GGATGGACAGATGGATGGGAGGG + Intronic
1143135400 17:4709967-4709989 GGATGTTAGCTGGGATGGGTGGG + Intergenic
1143175501 17:4952755-4952777 GGAAGATCACAGGGATGGCTGGG - Intronic
1143355308 17:6323574-6323596 TGAAGGTCACAGGGCTGGGACGG + Intergenic
1143416558 17:6755256-6755278 TGATGATCACAGTGATAGGAGGG - Intergenic
1143892547 17:10113767-10113789 GGTTGAGGACAGGGATGGGAAGG + Intronic
1144033184 17:11340611-11340633 GCTTGTACAGAGGGATGGGAGGG + Intronic
1147028030 17:37606225-37606247 AGATCGTCACAGAGATGGGAAGG - Intronic
1147515510 17:41114090-41114112 GCATCTTCACAGGCATAGGATGG - Intergenic
1148676019 17:49445575-49445597 GAATGTTCTCAGAGGTGGGAAGG - Intronic
1148749061 17:49934440-49934462 GGAGCTTCACAGGGACAGGAGGG - Intergenic
1148864902 17:50623465-50623487 CGGTGTCCACAGGGATGGGCTGG - Intronic
1150130384 17:62665972-62665994 GGGTGTTCACAGGGATCAGCAGG - Intronic
1151716506 17:75833913-75833935 GGATGCTCACAGGAACGGGTTGG - Intronic
1152326693 17:79645645-79645667 GGATGATGCCAGGGATGGGCTGG - Intergenic
1153119637 18:1705853-1705875 GGGAGTACAGAGGGATGGGAGGG - Intergenic
1154200947 18:12300304-12300326 GGATGATGACAGGGAAGGCATGG - Intergenic
1157882023 18:51329660-51329682 GGATATTCACAGAGGAGGGAGGG + Intergenic
1157948321 18:52006190-52006212 GGATGTTCATAGGGGAGTGATGG - Intergenic
1160989669 19:1855405-1855427 GAAAGCTCACAGGGAGGGGAGGG + Intronic
1161657777 19:5526342-5526364 GGATGGCCAGAGAGATGGGAGGG + Intergenic
1162311642 19:9911367-9911389 GGGTGGTGTCAGGGATGGGAGGG + Intronic
1162383584 19:10347261-10347283 GGTTGTGCAGGGGGATGGGAGGG + Intergenic
1163451393 19:17379375-17379397 GGAAGTTCCCAGGGGTGGGCAGG + Intergenic
1163735133 19:18975267-18975289 TGATGTGGACAGGGAAGGGATGG + Intergenic
1164499100 19:28798205-28798227 GAATGTTGACAGGGAGGTGATGG - Intergenic
1164708744 19:30339595-30339617 GGATGGTCCCTGGGCTGGGATGG + Intronic
1165653754 19:37515051-37515073 GGGTGTTCACTTGAATGGGAAGG - Intronic
1167687866 19:50967960-50967982 GGATATGCACAGGGTTGGGGTGG - Intronic
1168494605 19:56838846-56838868 GGTTGTCCACAGGGAGGGGCGGG - Intronic
1168504293 19:56920214-56920236 GGATGTGGAGAGGGAAGGGAAGG - Intergenic
925051754 2:820974-820996 GGATGTTGAAAGGGAAGGGGTGG + Intergenic
925583376 2:5437542-5437564 AGATGTTTACAAGGAAGGGAGGG - Intergenic
926961737 2:18364920-18364942 GGATTTTCATAGGCATAGGATGG + Intergenic
928439257 2:31278113-31278135 TAATGCTCACAGTGATGGGAGGG - Intergenic
929088123 2:38188790-38188812 TAATGTTCACAAGAATGGGAAGG + Intergenic
929823061 2:45289076-45289098 AGATGTTCACACTGCTGGGAAGG - Intergenic
930477133 2:51895748-51895770 GGTCCTTCACAGGGATGCGAAGG + Intergenic
931567047 2:63625622-63625644 GGATGTGAAGAGGGATGTGAAGG + Intronic
932566586 2:72914964-72914986 GCATCCTCACAGGGATGGAATGG + Intergenic
932870175 2:75390642-75390664 GGTGGCTCACAGGGGTGGGAAGG - Intergenic
933987624 2:87604797-87604819 GGTTATTCACAGGGTTGGGGTGG + Intergenic
935364045 2:102270818-102270840 GGATGTACAGATGGATGGGTGGG + Intergenic
935364056 2:102270858-102270880 GGATGTACAGATGGATGGGTGGG + Intergenic
935524673 2:104151064-104151086 GGAAATGCAAAGGGATGGGATGG + Intergenic
935600783 2:104919455-104919477 GAATGTTCACAGGCTTGGGCAGG + Intergenic
935635725 2:105248433-105248455 GGATGCACAGAGGGATGAGATGG + Intergenic
935815350 2:106842302-106842324 GGCTCTTGACAGGGATGTGAAGG + Intronic
936306216 2:111346011-111346033 GGTTATTCACAGGGTTGGGGTGG - Intergenic
936447391 2:112606939-112606961 ACATGCTCTCAGGGATGGGAAGG + Intergenic
936810341 2:116392148-116392170 GGAAGTTCTATGGGATGGGATGG - Intergenic
937710656 2:124976967-124976989 GGATGCTTAGAGGGATGGGAAGG + Intergenic
938793526 2:134698217-134698239 GGATGTCTCCAGGGAAGGGAGGG + Intronic
939443733 2:142281724-142281746 GGATGTTCCCTGGGATGACATGG - Intergenic
939968415 2:148633796-148633818 GGGTGGTGACAGGGATGGGAAGG - Intergenic
940524902 2:154800938-154800960 GGAGGCTCATAGGGATAGGAAGG - Intronic
941648538 2:168067929-168067951 GCAGGTTCACATGGCTGGGAAGG + Intronic
944438225 2:199714738-199714760 GGAGGGTCACAGGTATGGGATGG + Intergenic
944632695 2:201643189-201643211 CAGTGTTCACAGGAATGGGACGG - Intronic
945779441 2:214151077-214151099 AAATGGTCAAAGGGATGGGAAGG - Intronic
947769913 2:232662403-232662425 GCACGTTCACAGGGAAGGGCTGG - Intronic
948680063 2:239627488-239627510 GGCTGTTCACAGGGCGTGGAGGG - Intergenic
948769177 2:240239443-240239465 GGATGTTCAGATGGATGGATAGG + Intergenic
948795654 2:240400910-240400932 GGATATCCACAGGGAGGGGCCGG + Intergenic
1168772127 20:421969-421991 GGTTGGTGAGAGGGATGGGAAGG + Intronic
1169089162 20:2847413-2847435 GGATGAGCACAAGGGTGGGATGG - Intronic
1169684018 20:8250185-8250207 AGATTTTCACAGATATGGGATGG - Intronic
1171398997 20:24859424-24859446 GGAGGGGCACAGGGCTGGGAGGG + Intergenic
1171529509 20:25843619-25843641 GGTTGTGCCCAGGGAGGGGATGG - Intronic
1171530270 20:25848602-25848624 GGAGGTCCACAGGGTGGGGAAGG - Intronic
1171547317 20:26012261-26012283 GGTTGTGCCCAGGGAGGGGATGG + Intergenic
1172577042 20:36017433-36017455 GTATGTCCTCAGGGCTGGGAAGG + Intronic
1173132486 20:40407978-40408000 GGATGTTCTCAGAGAGGGGAAGG - Intergenic
1173217007 20:41094437-41094459 TGAGGTTCAAAGTGATGGGAGGG + Intronic
1173863155 20:46297374-46297396 GGAGGTGCTCAGGGATGGAACGG + Intronic
1173929054 20:46803399-46803421 GCATGTTCAGCGGTATGGGATGG - Intergenic
1175816766 20:61887109-61887131 GGATGTTCTCTGGGGTGAGAGGG - Intronic
1176118785 20:63444919-63444941 GGATGTGCAGAGGGGCGGGAAGG + Intronic
1176256982 20:64158054-64158076 GGTTGGGCACAGGGATGGGTGGG - Intronic
1176656326 21:9591618-9591640 GGAGGTCCACAGGGTGGGGAAGG - Intergenic
1177032973 21:16005358-16005380 GCTTTTTCACAAGGATGGGATGG + Intergenic
1178587148 21:33880090-33880112 TGATGTTCATGGTGATGGGAAGG + Intronic
1178721517 21:35014806-35014828 GGATGTTTACAGGGAGCTGAGGG - Intronic
1179719626 21:43307764-43307786 AGATGTCCACAGGGCTGGGGTGG - Intergenic
1179723444 21:43329011-43329033 GGACACTCACAGAGATGGGATGG + Intergenic
1180136725 21:45866791-45866813 GGAGGACCACAGGGAAGGGAGGG - Intronic
1183220721 22:36511127-36511149 AGATGCTCACAGGGCTGGGCAGG + Intronic
1183761767 22:39826729-39826751 GGATGTTGGTAGGGGTGGGAAGG + Intronic
1184651350 22:45920689-45920711 GGATGGGGTCAGGGATGGGATGG + Exonic
1185191653 22:49440956-49440978 AGATGCTCACAGGGATGTCACGG - Intronic
949091534 3:34924-34946 AAATGTTTACAGGGATGGAATGG + Intergenic
950258194 3:11523127-11523149 GGATGTTCTCAGGGATGACTTGG - Intronic
950326886 3:12119289-12119311 GAATGTTCACAGGGAAGGAAAGG - Intronic
952367111 3:32685041-32685063 GGATGTTCACAGGGCTGACGCGG - Intergenic
953069597 3:39506056-39506078 GGAAGATCACAGGGAGGGGTGGG - Intronic
954130151 3:48556630-48556652 GGAGGTGCACCGGGATGGGTGGG - Intronic
956905685 3:73762826-73762848 GGATGTACACAGAGAGGGCATGG - Intergenic
958027102 3:88060504-88060526 GCATTTTAAAAGGGATGGGATGG - Intronic
960615114 3:119589335-119589357 GCCTGTTCTCAGGGGTGGGAAGG + Exonic
962170357 3:133095236-133095258 GGATGTAGTCAGGGATGGGGAGG + Intronic
962680265 3:137792028-137792050 GCAGGTACACAGGGGTGGGATGG + Intergenic
962781496 3:138722745-138722767 GGCTGTTCACACAGATGGTACGG - Intronic
964153190 3:153553405-153553427 GAATGTTCCCTGTGATGGGATGG - Intergenic
964186705 3:153954254-153954276 GACTGGTCACTGGGATGGGAGGG - Intergenic
967119584 3:186371098-186371120 GAATGTTCAGTGGGAGGGGAGGG - Intergenic
969874232 4:10124129-10124151 GGATGAAAACAGGGATGGGGTGG - Intergenic
970894312 4:21084717-21084739 GGATCTAAATAGGGATGGGAGGG - Intronic
972024797 4:34363128-34363150 GGTGGCTCACAGGGATGAGAAGG - Intergenic
972769122 4:42179781-42179803 GGATGGTGGCAGGAATGGGATGG + Intergenic
973160970 4:47016005-47016027 GAAAGTTCACAAGGATGAGATGG + Intronic
974234358 4:59161372-59161394 GCATGTTCACAGTGGTGGGTCGG - Intergenic
976164758 4:82242387-82242409 AGAAGTTCATAGGAATGGGAAGG + Intergenic
977381166 4:96275450-96275472 GGAAATTTGCAGGGATGGGATGG - Intergenic
977661804 4:99597016-99597038 GGATGTTCACAGTTATGAGTGGG + Intronic
978165102 4:105597490-105597512 GGAAGTGAACAGAGATGGGAAGG - Intronic
978317682 4:107457785-107457807 GGAGATTCACAGGGGTGGAATGG - Intergenic
981223460 4:142264000-142264022 TGAAGTTCCCAGGGTTGGGACGG + Intronic
989829678 5:45899921-45899943 GGATGTTCACACAGAGGGAAAGG - Intergenic
990518103 5:56549661-56549683 GTACTTTAACAGGGATGGGATGG + Intronic
992028897 5:72700889-72700911 GTATGTACCCAGTGATGGGATGG + Intergenic
992886890 5:81168186-81168208 GGAGGTGAAAAGGGATGGGATGG - Intronic
993775249 5:91986728-91986750 GGAATTCAACAGGGATGGGAGGG + Intergenic
994712551 5:103283116-103283138 GAATGTTCAGAGGGCTGTGATGG + Intergenic
995412462 5:111874028-111874050 GAATGTTCCCAGGGACGGGAGGG + Intronic
995812034 5:116118128-116118150 GGATGTTCATAGGGCTGGCTTGG + Intronic
995865259 5:116683537-116683559 TGATGTTCAAAGCGATGGCAGGG + Intergenic
996792443 5:127307284-127307306 TCAAGTTCACAGGGTTGGGAAGG - Intronic
997388684 5:133496003-133496025 GGATGTTCAGAGGCAGAGGAGGG + Intronic
998266160 5:140669324-140669346 GGATGTTCACAGCCCTGGGCAGG - Exonic
998498819 5:142614335-142614357 GGATGGTCCCAGGCCTGGGAGGG + Intronic
998807568 5:145933796-145933818 GCATTTTCTCAGGGATGGGAAGG + Intergenic
999810228 5:155120532-155120554 GGATGGGCCCAGGGATGGGATGG + Intergenic
1000242752 5:159423699-159423721 GCAGGTTTACAGGGTTGGGAGGG + Intergenic
1002295345 5:178227634-178227656 ACATGTGCACAGGGCTGGGAAGG + Intronic
1002674180 5:180896847-180896869 GTATGTGCCCAGGAATGGGATGG + Intergenic
1003026301 6:2558533-2558555 GGATGCTCACAGGGGTGTGGGGG - Intergenic
1004178945 6:13364681-13364703 GGATGTCCACAGAGAGGGAAGGG - Exonic
1005730940 6:28696220-28696242 GCAAGTTAACAGGAATGGGAAGG - Intergenic
1005843143 6:29757756-29757778 AGAAGTTCTCAGGTATGGGAGGG + Intergenic
1006188353 6:32192683-32192705 GGAAGTTGACAGGGATGGGCGGG - Exonic
1006733549 6:36254896-36254918 GGATGTTCAAAGGGAGGGCAGGG + Intronic
1006802877 6:36770594-36770616 AGATGGTCAGAGGGATAGGAGGG - Intronic
1007755688 6:44097764-44097786 GGGTGTTCACATGGAAGGGATGG - Intergenic
1009572755 6:65409454-65409476 AGAAGTTCACAGAGATGGCAAGG - Intronic
1012658595 6:101857423-101857445 GTAAGTCCACAGAGATGGGAAGG + Intronic
1012767901 6:103392848-103392870 GGATGTTCATATGTATGGCAGGG - Intergenic
1013794629 6:113873199-113873221 GGATGTTTGCTGGGATGAGAAGG + Intergenic
1017073799 6:150600048-150600070 GGACTTTTCCAGGGATGGGAGGG + Intronic
1018216383 6:161531830-161531852 GGAGGTGCTCAGGGATGAGAAGG + Intronic
1019160926 6:170066496-170066518 GGGTGGACAGAGGGATGGGATGG - Intergenic
1019254402 7:40046-40068 GAATGGACAGAGGGATGGGAGGG - Intergenic
1020467980 7:8502827-8502849 AGCTGTTCACAGAGATGGGCTGG + Intronic
1020896357 7:13945014-13945036 GGATGTCAGCAGGGATCGGAGGG - Intronic
1022913712 7:34925531-34925553 GGATTTTCCAAAGGATGGGAAGG - Intergenic
1023017743 7:35983819-35983841 TGGTGTTCCCAGGGATGTGAGGG - Intergenic
1024518065 7:50277554-50277576 GGATGTACAAAGGGATGAGAAGG - Intergenic
1025014797 7:55430460-55430482 GGGGGACCACAGGGATGGGAGGG + Intronic
1031135775 7:117882550-117882572 AGTTGTTCACAGGGGTGGGTGGG + Intergenic
1031621398 7:123938150-123938172 GGCTGTTCACAGGCATGATATGG + Intronic
1031871250 7:127091705-127091727 GGATGATCAGTGGGATGGCAGGG - Intronic
1031871262 7:127091746-127091768 GGATGATCAGTGGGACGGGAGGG - Intronic
1032508214 7:132451806-132451828 TGATTGGCACAGGGATGGGATGG + Intronic
1035010875 7:155714080-155714102 GGATGTGCGCAGGGATGGATGGG + Intronic
1035238133 7:157513456-157513478 GGACGTTCACAGGAAGGAGAGGG - Intergenic
1035246675 7:157566840-157566862 GCGTCTCCACAGGGATGGGATGG - Intronic
1035260668 7:157659453-157659475 GGATGGTCACAGGGATGGGGGGG + Intronic
1036416555 8:8554855-8554877 TGATGCTCACAGGGATGTGCAGG - Intergenic
1037040546 8:14226401-14226423 CGTAGTTCACAGGGATGGTATGG - Intronic
1037652831 8:20854978-20855000 GGATCTGGACAGGGATGGTAAGG + Intergenic
1039442335 8:37603628-37603650 CAATGTTCACACGGATGGGAAGG + Intergenic
1039641191 8:39225148-39225170 GGGTGTGCACAGGGTTGGGAGGG - Intronic
1041253004 8:55953088-55953110 GGATGCACACAGGAATGGGAGGG - Intronic
1041801754 8:61807852-61807874 GGAAGTTCAGAGGGCTGGGCAGG + Intergenic
1042090069 8:65149260-65149282 ACATGCTCACAGGGAGGGGAAGG - Intergenic
1042383101 8:68141750-68141772 CTATGTTTACAAGGATGGGATGG + Intronic
1043302810 8:78755035-78755057 GGATGTTCACAGGCAGAAGAAGG - Intronic
1043877772 8:85505883-85505905 GTCTGTTCTCAGTGATGGGAGGG - Intergenic
1043993687 8:86787181-86787203 GGCTGCTCACTGAGATGGGAAGG + Intergenic
1045343613 8:101275058-101275080 GCATGTCCACAGGGAGGGGGTGG + Intergenic
1045407800 8:101884370-101884392 GGATATTAATAGGGATAGGAAGG - Intronic
1047785445 8:128150017-128150039 GGATATTTAGAGGGAAGGGAGGG - Intergenic
1047974539 8:130116257-130116279 GAATGTGCACAGGAAGGGGAGGG + Intronic
1048002553 8:130391254-130391276 GGTTATTTCCAGGGATGGGAAGG + Intronic
1048314054 8:133349187-133349209 GGATGTTGGCAGGGTAGGGAAGG - Intergenic
1048854894 8:138678228-138678250 GGATGTTCATGGGGATATGAAGG + Intronic
1049884431 9:17915-17937 GGAGGCTGACTGGGATGGGATGG - Intergenic
1051365403 9:16318198-16318220 GGCTGTGCAGAGTGATGGGAAGG + Intergenic
1051421076 9:16889970-16889992 GGATGTTCATAATAATGGGAAGG - Intergenic
1053434061 9:38063592-38063614 GTGTGTGCACAGGGTTGGGAGGG - Intronic
1056458931 9:86790744-86790766 GTATGGTGACAGGGATGGGAAGG - Intergenic
1057226104 9:93294051-93294073 GGATGTCCTTCGGGATGGGAGGG + Intronic
1057629596 9:96708558-96708580 GGAAGTAGAGAGGGATGGGAGGG + Intergenic
1057875356 9:98749401-98749423 GAATGTTCACGGGGAGAGGAAGG - Intronic
1057988335 9:99740961-99740983 GGATTTTTACAGGGAGGGAAGGG + Intergenic
1059486631 9:114632337-114632359 TGGTTGTCACAGGGATGGGATGG - Intronic
1060734645 9:126059240-126059262 GGATGTACAGAGGGCTGGGTAGG - Intergenic
1062500501 9:136849999-136850021 AGATGTCCGCTGGGATGGGAGGG - Exonic
1062622985 9:137430966-137430988 GGTCTTACACAGGGATGGGATGG - Intronic
1062745998 9:138212495-138212517 GAATGGACAGAGGGATGGGAGGG + Intergenic
1203634042 Un_KI270750v1:95100-95122 GGAGGTCCACAGGGTGGGGAAGG - Intergenic
1185603946 X:1356360-1356382 GGATGTCCACGGGGGTGGGGGGG - Intronic
1186559767 X:10598962-10598984 GGATGGTCATAGAGAAGGGAAGG - Intronic
1187158033 X:16739279-16739301 GGATGGACACAGGGATGGATAGG - Intronic
1187487457 X:19717996-19718018 GGATGTCTACTGGGAGGGGAAGG + Intronic
1187824244 X:23318705-23318727 GGAAGGCCACAGGGATGGCAGGG + Intergenic
1188691319 X:33132408-33132430 GGAGGATCACAGGGATGGCTGGG - Intronic
1192478793 X:71467054-71467076 AGATATTCATAGGGGTGGGATGG + Intronic
1193254929 X:79337067-79337089 TGCTGTTTACAGGGATGTGAAGG + Intergenic
1193487733 X:82107587-82107609 GGAAGTTCTCAGGCATAGGAAGG + Intergenic
1198998815 X:142607728-142607750 GAATGTTGACAGTGAAGGGAGGG + Intergenic
1199471237 X:148198524-148198546 GGAAGTTCAGGAGGATGGGAAGG + Intergenic
1199885836 X:152021359-152021381 AGATGTGCACAGGTATGGTAAGG + Intergenic