ID: 1063299716

View in Genome Browser
Species Human (GRCh38)
Location 10:4840611-4840633
Sequence CCCAGGATGTTCACAGGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 242}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063299716_1063299726 11 Left 1063299716 10:4840611-4840633 CCCATCCCTGTGAACATCCTGGG 0: 1
1: 0
2: 0
3: 28
4: 242
Right 1063299726 10:4840645-4840667 TGAAGCTGCTGTGGGGTCCTTGG No data
1063299716_1063299722 2 Left 1063299716 10:4840611-4840633 CCCATCCCTGTGAACATCCTGGG 0: 1
1: 0
2: 0
3: 28
4: 242
Right 1063299722 10:4840636-4840658 TCAGCCACATGAAGCTGCTGTGG No data
1063299716_1063299724 4 Left 1063299716 10:4840611-4840633 CCCATCCCTGTGAACATCCTGGG 0: 1
1: 0
2: 0
3: 28
4: 242
Right 1063299724 10:4840638-4840660 AGCCACATGAAGCTGCTGTGGGG No data
1063299716_1063299723 3 Left 1063299716 10:4840611-4840633 CCCATCCCTGTGAACATCCTGGG 0: 1
1: 0
2: 0
3: 28
4: 242
Right 1063299723 10:4840637-4840659 CAGCCACATGAAGCTGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063299716 Original CRISPR CCCAGGATGTTCACAGGGAT GGG (reversed) Intronic
901851967 1:12021666-12021688 CGCAGGATGTCCTCAGGGCTGGG - Exonic
903274606 1:22212602-22212624 CCCAGGCTGGGCACCGGGATGGG + Intergenic
903338087 1:22637970-22637992 CCCAGGCAGTACACAGGGAGTGG - Intronic
903623864 1:24717367-24717389 TTCAGGTTGTTCACAGAGATGGG - Intergenic
904036825 1:27563551-27563573 CCCAGGCTGGTGACAGTGATGGG - Intronic
904441356 1:30534061-30534083 CCCAGGATGCTCAGAAGGGTGGG + Intergenic
904629369 1:31829700-31829722 CCCAGGAGGTTCCCAGGGTTAGG + Intergenic
909283723 1:73789050-73789072 CCCAGGATGTGCACTGTAATGGG + Intergenic
912947229 1:114095475-114095497 CCCAGCCTGGTAACAGGGATGGG + Intronic
913218079 1:116637175-116637197 CGCAGGATGTCCACAGGCACAGG - Intronic
914239926 1:145846494-145846516 CCCAAGATGGTCCCAGGCATGGG - Intronic
915875971 1:159612559-159612581 TCCAGCCTATTCACAGGGATGGG - Intergenic
915900196 1:159841184-159841206 CCCAGGATGTGCACAGCTGTGGG + Exonic
917629596 1:176879096-176879118 GCCAGCATGGTCACAGGGCTGGG + Intronic
917759662 1:178142287-178142309 CCCAGGATGTGTCTAGGGATGGG + Intronic
920424925 1:205867398-205867420 CCCAGGATGTGTCTAGGGATGGG + Intergenic
921436957 1:215134746-215134768 CCCAGGAAATTCTAAGGGATTGG + Intronic
922684166 1:227626393-227626415 CCCAGGATGTATCCAGGGATGGG + Intronic
922823635 1:228502112-228502134 CCCAGGCTGTCCACATGGACTGG + Intergenic
923572631 1:235129887-235129909 CACAGGATATTTACAGGGAAGGG + Intergenic
1062865389 10:847885-847907 CCCAGGCTGTGCCCAGGGAGTGG + Intronic
1063299716 10:4840611-4840633 CCCAGGATGTTCACAGGGATGGG - Intronic
1064279930 10:13942304-13942326 CCCAGGCAGTACACAGGGAGGGG - Intronic
1067068617 10:43117231-43117253 GCCTGGCTGTTCACAGGGCTGGG - Intronic
1067723039 10:48743925-48743947 CCCAGGATGCTGCCAGGGGTGGG + Intronic
1068287624 10:54961356-54961378 CCCAGGATGTTCATGTGGAGGGG - Intronic
1068574032 10:58663485-58663507 CCCAGGCTGTGCACTGGTATCGG + Intronic
1071841351 10:89475150-89475172 GCCAGGATGTTAACTGGGGTGGG - Intronic
1073601604 10:104851438-104851460 CTCAGGCTGTGGACAGGGATGGG - Intronic
1074177992 10:111030235-111030257 CTCAGGGTTTTCACAGGCATAGG + Intergenic
1074399955 10:113133853-113133875 CCTAGGAGGCTCTCAGGGATTGG + Intronic
1074453187 10:113575909-113575931 CCCACCGTGTTCACAGGGGTTGG - Exonic
1075245928 10:120822173-120822195 CCCAGGAAGCACACTGGGATTGG + Intergenic
1075397996 10:122141555-122141577 CCCAGGGTGTTCTCAGAGATGGG + Intronic
1075977817 10:126711572-126711594 CCTAGGCTGATCTCAGGGATGGG + Intergenic
1076166838 10:128289050-128289072 CCCAGGAGGTTGACTGGGAAAGG - Intergenic
1077216300 11:1396534-1396556 CTCAGGCTGTTCCCAGGGACTGG - Intronic
1077562131 11:3270711-3270733 CCCAGGAAGTGCAAGGGGATTGG - Intergenic
1077568025 11:3316531-3316553 CCCAGGAAGTGCAAGGGGATTGG - Intergenic
1079197359 11:18341333-18341355 CCCATTATTTTCACAGGGATCGG + Exonic
1079887436 11:26005026-26005048 CCCAGGATGTGTCTAGGGATGGG - Intergenic
1079933438 11:26591948-26591970 CCCAGGATGTATCTAGGGATGGG + Intronic
1080937922 11:36882830-36882852 CCCAAGATGTACCCCGGGATGGG - Intergenic
1082160424 11:48883240-48883262 CTCAGGAGGTGCACAGGGCTGGG + Intergenic
1082160533 11:48883860-48883882 CCCCTGCTGTGCACAGGGATGGG + Intergenic
1082161833 11:48896546-48896568 CCCCTGCTGTGCACAGGGATGGG - Intergenic
1082161942 11:48897166-48897188 CTCAGGAGGTGCACAGGGCTGGG - Intergenic
1082167527 11:48965610-48965632 CTCAGGAGGTGCACAGGGCTGGG - Intergenic
1082236144 11:49821668-49821690 CCCCTGCTGTGCACAGGGATGGG + Intergenic
1082239490 11:49855596-49855618 CTCAGGAGGTGCACAGGGCTGGG + Intergenic
1082609534 11:55280968-55280990 CTCAGGAGGTGCACAGGGCTGGG + Intergenic
1082609647 11:55281588-55281610 CCCCTGCTGTGCACAGGGATGGG + Intergenic
1082657039 11:55868940-55868962 CCCCTGCTGTGCACAGGGATGGG - Intergenic
1082951034 11:58816163-58816185 CCCAGGATGTGCAAAGGGTCAGG + Intergenic
1084213575 11:67634882-67634904 CCCAGGATCTTCACCTGGAAGGG + Exonic
1084433444 11:69123970-69123992 CCCTGGATTTTCTCGGGGATTGG - Intergenic
1085464616 11:76715406-76715428 CCCAAGCAGTTCACAGGGTTAGG - Intergenic
1085844971 11:80054742-80054764 CCCAGGGTGTGCCCAGGGCTAGG - Intergenic
1088864697 11:113836586-113836608 GACAGGATGTCCTCAGGGATTGG - Intronic
1088878351 11:113954372-113954394 CCCAGGTTGATTACAGGGTTAGG + Intergenic
1089108343 11:116034252-116034274 CCTAAGATGATCAAAGGGATTGG - Intergenic
1089340339 11:117752974-117752996 CCCAGGATGGTGGCAGGGGTGGG + Intronic
1089897882 11:121950464-121950486 CCCTAGATGACCACAGGGATTGG + Intergenic
1091793996 12:3287010-3287032 CCCGGGAACATCACAGGGATTGG - Intergenic
1092934035 12:13343367-13343389 CCCAGGATGTCCACCAGGTTTGG - Intergenic
1093067337 12:14671730-14671752 CCCATGATCTTCACAGAGAGAGG - Intronic
1096189302 12:49605011-49605033 CCCAGGAAGTTCATAGGGGTTGG - Intronic
1096192626 12:49630495-49630517 CCCAGGATGGGCACAGAGATGGG - Intronic
1096351560 12:50905157-50905179 CCCAGGATGTATCTAGGGATGGG + Intergenic
1099045986 12:77720299-77720321 CCCAGGCTGTTCACAGAGGAAGG + Intergenic
1103731651 12:123031839-123031861 CCCAGAAGGTGCACAGGGAAAGG + Intronic
1104034918 12:125091555-125091577 CCCAGGATGCTCACAGGGCAAGG - Intronic
1104068569 12:125326062-125326084 ACCACGCTGTTCACAGGGAGAGG + Intronic
1105543352 13:21333874-21333896 TTCAGGGTGTTAACAGGGATGGG - Intergenic
1105675752 13:22670140-22670162 CCCCGGATGTGCAGAGGGAGAGG - Intergenic
1106549792 13:30761203-30761225 CCCAGGCTGTGCACAGGGTGTGG - Intronic
1107022648 13:35767199-35767221 CCCTGGATGTTCACAGGGTGGGG - Intergenic
1108569015 13:51730921-51730943 CCCAGCATGGTCTCAGTGATGGG - Intronic
1110308214 13:74015511-74015533 CCCATGAGTTTCACAGGGTTGGG + Intronic
1110567866 13:76974450-76974472 CCCAGGATTGCCACAGGGAATGG + Intergenic
1111453585 13:88450825-88450847 CCCAGGATGTTTTCTGGGAAAGG + Intergenic
1112053801 13:95671325-95671347 CCCAGCATATTCACAGCTATGGG - Intergenic
1112493259 13:99885577-99885599 GCCAGGATGTTTATAGGGAGTGG - Intronic
1112508454 13:99989331-99989353 CCCAGGATGATAACCGGCATCGG + Intergenic
1112993057 13:105537123-105537145 CCCAGCATTTTCACAGGCAGAGG - Intergenic
1114653722 14:24303322-24303344 CCCAAGGAGTTCACAGGAATGGG + Intronic
1115064086 14:29233954-29233976 CCCAGAATTTTCACAGCAATTGG - Intergenic
1116021966 14:39472111-39472133 CCCTGGTTGTTCTCAGGGTTTGG + Intergenic
1116446945 14:45021715-45021737 CCCAGGATGTATCTAGGGATGGG + Intronic
1116899400 14:50347504-50347526 TCCAGGATTTTCTGAGGGATTGG + Intronic
1119177447 14:72579610-72579632 CCCAGGATGCTCAGAGGGGCTGG - Intergenic
1119655141 14:76412234-76412256 CCCAAGCTGTTCGCAGGGTTTGG + Intronic
1120083445 14:80241514-80241536 CCCAGGATATTCCAAGGGATTGG - Intronic
1120565395 14:86048562-86048584 CCCAGGAAGTGCAAAGGGTTGGG - Intergenic
1120691996 14:87603095-87603117 CCCAGGATGTTGACACTGAAAGG - Intergenic
1121257404 14:92540741-92540763 CCCAGGCTGTTCACTGGGGCAGG + Intronic
1121412473 14:93757481-93757503 ACCAGAATGTTCTCAGAGATGGG + Intronic
1122994403 14:105255065-105255087 CCCAGGTTGTTCACTGGCCTGGG - Intronic
1124514389 15:30354347-30354369 CCCAGGAAATTCCAAGGGATTGG - Intergenic
1124728531 15:32176418-32176440 CCCAGGAAATTCCAAGGGATTGG + Intergenic
1124889611 15:33720389-33720411 CCCATGATGCTCAGAGGAATGGG - Intronic
1125328248 15:38558912-38558934 CCCAGGAGGCTCCCAGGGTTGGG + Intronic
1127073777 15:55307098-55307120 CCCAGGATGTGTCTAGGGATGGG + Intronic
1127921951 15:63501478-63501500 CCCCGGATGTCCAGAGGGCTGGG + Intergenic
1128712089 15:69879597-69879619 CCCAGAAGGAGCACAGGGATTGG - Intergenic
1130544992 15:84850203-84850225 ACCAGGACCTTAACAGGGATGGG - Intronic
1131533676 15:93216003-93216025 ACCAGAATGTTCCCAGAGATAGG - Intergenic
1131542413 15:93286130-93286152 CCCCGGTTCTTCACAGGGTTAGG + Intergenic
1132361559 15:101220409-101220431 CCCAGGGAACTCACAGGGATAGG - Intronic
1133144135 16:3770940-3770962 CCCAGCATGTTGAGAGGGTTAGG + Exonic
1134669072 16:16041301-16041323 CCCAGCATGTACTCAGGGCTAGG - Intronic
1135510067 16:23074952-23074974 CTCAGGATGGCCCCAGGGATGGG + Intronic
1135940320 16:26816733-26816755 CCCAGGATGGACAGAGGGAGAGG - Intergenic
1136710647 16:32234147-32234169 CACAGGATGTTCCCAGGACTGGG - Intergenic
1136757264 16:32695264-32695286 CACAGGATGTTCCCAGGACTGGG + Intergenic
1136810844 16:33175111-33175133 CACAGGATGTTCCCAGGACTGGG - Intergenic
1136817320 16:33285191-33285213 CACAGGATGTTCCCAGGACTGGG - Intronic
1136823883 16:33341720-33341742 CACAGGATGTTCCCAGGACTGGG - Intergenic
1137480782 16:48850238-48850260 CCCAGGAGGAGCCCAGGGATGGG + Intergenic
1138157968 16:54723529-54723551 CCCAGAATGTCAACAGGGACTGG - Intergenic
1138423830 16:56917099-56917121 CCAAGAATGTTCACAGAAATGGG + Intergenic
1138929757 16:61638647-61638669 CCCAAATTGTTCACAGGGAATGG + Intergenic
1139287946 16:65832173-65832195 CCCAGGATGTTGAACGGGAGGGG - Intergenic
1141819467 16:86434953-86434975 CCCCGGAAGGTCTCAGGGATGGG + Intergenic
1203059414 16_KI270728v1_random:955615-955637 CACAGGATGTTCCCAGGACTGGG + Intergenic
1146997573 17:37334429-37334451 CCCAGGATGTATCTAGGGATGGG - Intronic
1147332089 17:39705284-39705306 CCCAGGGTCTCCACAGGGCTGGG - Intronic
1148495913 17:48053537-48053559 CCTAGGCTGTTGTCAGGGATAGG + Intronic
1148749063 17:49934444-49934466 CCTAGGAGCTTCACAGGGACAGG - Intergenic
1149026184 17:52030138-52030160 CCCCTGATGATCACAGGGACTGG + Intronic
1149139144 17:53408886-53408908 CCCAAGATGTTTTCAGGGAGTGG - Intergenic
1149642663 17:58214047-58214069 CCCAGGATGATAACAGGAAGGGG + Intronic
1149708976 17:58721331-58721353 CCCAGGGAGTTCACAGTGTTAGG + Intronic
1150223309 17:63509253-63509275 CCCAGGAGGTGGGCAGGGATGGG - Intronic
1150606080 17:66692108-66692130 CCCAGGATGCTCACAGCCTTGGG - Intronic
1151025190 17:70669675-70669697 CCCAGAATCTTCTCAGGCATGGG - Intergenic
1151483349 17:74383433-74383455 CACAGGATGCTCACGGGGAGGGG - Intergenic
1152336885 17:79703726-79703748 CCAAGGCTGTCCACAGGGATGGG + Intergenic
1152725696 17:81944595-81944617 CCCAGGAAATTCAAGGGGATTGG - Intronic
1153811475 18:8755724-8755746 AACAGAATGTTCACAGGGAGTGG + Intronic
1158745702 18:60197230-60197252 CCCATTATTTTCACAGGGATTGG + Intergenic
1159018006 18:63117995-63118017 CTCAGAATGTTCACATGGCTTGG + Intergenic
1160929495 19:1563512-1563534 CCCTGCATGTTCCCAGGGACAGG - Intronic
1161785408 19:6322039-6322061 CCCAGGATGCTTGCAGGGAAGGG + Intronic
1167250325 19:48395747-48395769 CCCAGGATGTTGGGAAGGATAGG + Intronic
1167493718 19:49806158-49806180 CCCACGAAGTTCTCAGGGTTGGG - Exonic
925183170 2:1830149-1830171 ACCAAGATCATCACAGGGATCGG + Intronic
926243099 2:11103138-11103160 CCCGTGCTGTTCACAGGGCTGGG + Intergenic
926961735 2:18364916-18364938 CCCAGGATTTTCATAGGCATAGG + Intergenic
927148182 2:20180384-20180406 CCCCGGATGCTCCCAGGGAGGGG - Intergenic
929471605 2:42199302-42199324 GCTAGGATGTTCACGTGGATTGG + Intronic
931194023 2:60033421-60033443 CCCAGGATGAGGTCAGGGATTGG - Intergenic
933284691 2:80373079-80373101 CCTAGAATGATCACAGGGCTAGG - Intronic
937178987 2:119972192-119972214 ACCAGAATGTTCATAGGGATTGG + Intronic
937186965 2:120053016-120053038 ACCAGCATGTACACAGGGAGAGG - Intronic
937276118 2:120685285-120685307 TCCAGGATTATCACAGGGAAAGG - Intergenic
937334716 2:121055033-121055055 TCCATGATGTTCACAGGGAGGGG + Intergenic
937438757 2:121899905-121899927 CCTGGGATGTTCACAGGCACTGG - Intergenic
939297196 2:140282573-140282595 CCTAAGATGTCCACAGAGATGGG - Intronic
940846265 2:158645488-158645510 CACAGGAAGTTCAAAGTGATGGG - Intronic
945432378 2:209779193-209779215 CCCAGGAGGTGCACAGGGGTAGG - Intronic
946728083 2:222681765-222681787 CTCAGGAAGTTCCAAGGGATTGG + Intronic
947033431 2:225824433-225824455 CCCAGGAAGTGCACAGAGCTGGG + Intergenic
947769915 2:232662407-232662429 CCCAGCACGTTCACAGGGAAGGG - Intronic
948705805 2:239791898-239791920 GCCATGCTGTTGACAGGGATGGG + Intronic
949009853 2:241672252-241672274 CCCAGGATTTTCAAAGGGACAGG - Exonic
1168818698 20:759109-759131 CACAGTAAGTTAACAGGGATGGG + Intergenic
1170357623 20:15509465-15509487 GCCAGGATGTTCCTAGGGTTGGG + Intronic
1174095870 20:48089110-48089132 CCCAGCAGGTTCACACAGATGGG - Intergenic
1176294967 21:5066843-5066865 CTCAGGATGTGCACAGGCATTGG + Intergenic
1178019700 21:28394721-28394743 CCCAGAATGTATACAGGTATGGG - Intergenic
1179417404 21:41209331-41209353 CCCAGGCTGTTCCCAGGGGGAGG + Intronic
1179862082 21:44195284-44195306 CTCAGGATGTGCACAGGCATTGG - Intergenic
1180819386 22:18815259-18815281 CGCAGGATGTCCACAGGCACAGG - Intergenic
1180919811 22:19515919-19515941 CCCAGGATGTGCACCAGGATGGG - Intronic
1181038807 22:20182335-20182357 CCCAGGGTGGGCACAGGCATGGG + Intergenic
1181051805 22:20241533-20241555 CCCATCATGTTTACAGGGTTCGG - Exonic
1181205611 22:21249704-21249726 CGCAGGATGTCCACAGGCACAGG - Intergenic
1181764283 22:25080006-25080028 CCCAGGATGTGCTCATGGATTGG + Intronic
1181860130 22:25811928-25811950 CCCTGGATGTTAACACGGACAGG + Intronic
1184185432 22:42861747-42861769 CCCAGGATGCTCAAAGGGTGGGG - Intronic
1203221312 22_KI270731v1_random:45709-45731 CGCAGGATGTCCACAGGCACAGG + Intergenic
1203269514 22_KI270734v1_random:41112-41134 CGCAGGATGTCCACAGGCACAGG - Intergenic
949416720 3:3823072-3823094 CCCAGGGTCTTCACTGTGATTGG + Intronic
950799286 3:15536456-15536478 CACAGGATGGTCAAAAGGATAGG - Intergenic
950923748 3:16719999-16720021 TGCAGGATGTTCACAGCAATTGG - Intergenic
953461070 3:43081501-43081523 CTCAGGATGCCCATAGGGATGGG - Exonic
954123773 3:48516840-48516862 CCCATGATGTTCTGAGGCATGGG + Intergenic
955812126 3:62802508-62802530 CCCAGCATCTTCAAAGTGATAGG + Intronic
959082970 3:101821802-101821824 CGGAGGATGTTCTCAGGGGTTGG + Exonic
960177204 3:114531869-114531891 CCCAGGAAGCACACAGGGTTGGG + Intronic
961522465 3:127475055-127475077 CCCAGGATGTTCCTGGGGAGAGG + Intergenic
963306518 3:143659666-143659688 CACAGGGTGATGACAGGGATAGG - Intronic
967151251 3:186652762-186652784 CTCAGCATGTTGACTGGGATTGG + Exonic
967913360 3:194559948-194559970 CCCAGGATGTCCTCAGAGTTTGG + Intergenic
968027678 3:195456252-195456274 CCAAGGATGCACACAGGGAAGGG - Intergenic
971257496 4:25028709-25028731 CCCAGGATCTTCCCCGGGGTAGG + Intronic
972614488 4:40685135-40685157 CCAAGGAAGGCCACAGGGATGGG + Intergenic
973787670 4:54348698-54348720 CCAAGGATGTTTACAGAAATGGG + Intergenic
975640804 4:76498226-76498248 CCCAGGGAGTTCACACAGATGGG + Intronic
975681624 4:76882996-76883018 CACAGGCTGTTCACAGGATTAGG + Intergenic
975881613 4:78915135-78915157 CCCAACACGTACACAGGGATTGG - Exonic
978698648 4:111615738-111615760 CCCAGGAGGTTTAGAGGAATCGG + Intergenic
980705694 4:136490264-136490286 TCCAGGATGTAGACAGGGAAGGG + Intergenic
980872288 4:138624432-138624454 CCCAGGATGTATCTAGGGATGGG + Intergenic
981748869 4:148074653-148074675 CCCAGGATGTACTGAGGAATGGG + Intergenic
982183787 4:152775857-152775879 CCCATCATGTTCACAGGGAGAGG + Intronic
983181656 4:164655931-164655953 CCCAGGATGTATGTAGGGATGGG - Intergenic
984144037 4:176039390-176039412 TCCAGGATGTTCACAGTTTTGGG + Intergenic
985037167 4:185852155-185852177 CTGGGGATGTTTACAGGGATCGG - Intronic
985710492 5:1425088-1425110 CCCAGGATGTTCACCAGGCGTGG + Intronic
985875102 5:2588381-2588403 CCCAGCAAGTGCACAGGGAAAGG + Intergenic
986733816 5:10653681-10653703 CTCAGGATGTGGACAGGGCTGGG + Intergenic
991180999 5:63751032-63751054 GCCTGGAGTTTCACAGGGATGGG + Intergenic
992215589 5:74521861-74521883 GGAAGGATGTTCACAGGGAGAGG + Intergenic
993029911 5:82694246-82694268 CCCAGGAAGGTGACAGGGCTGGG + Intergenic
994980991 5:106875120-106875142 CCCAGGATGTATTCAGGTATGGG + Intergenic
995125898 5:108576784-108576806 CCCAGGATGTATCTAGGGATGGG + Intergenic
995271765 5:110227940-110227962 CCCAAGATGTTGACTGGGCTGGG - Intergenic
999077594 5:148811741-148811763 CCAAGGATATTCACAGTGATGGG - Intergenic
999732169 5:154482951-154482973 CCCAGCCTGCTCCCAGGGATGGG + Intergenic
1001782247 5:174379943-174379965 CCCAGGGTGTGCACAGGCTTTGG - Intergenic
1002690551 5:181046844-181046866 CCCAGGAAGTTGACAGGTAGGGG + Intronic
1003176711 6:3757474-3757496 CCCAGGAAATTCACAGGCACTGG - Intergenic
1006591025 6:35157794-35157816 CCCAAAATGTTCAAAGTGATGGG - Intergenic
1006871767 6:37257979-37258001 CCCAGGACGCTGAGAGGGATAGG + Intronic
1007108329 6:39298350-39298372 TCCAAGATGGTCACAGGGAGAGG + Intergenic
1007207261 6:40163000-40163022 CCCTGGCAGTTCCCAGGGATGGG - Intergenic
1007378704 6:41472914-41472936 CCTAGGCTGTTCACACGGAGAGG - Intergenic
1007810918 6:44485096-44485118 CCCAGGATGTTCACATTGAAAGG - Intergenic
1011189261 6:84713206-84713228 CCCAGGATGTATCTAGGGATGGG + Intronic
1013682515 6:112541130-112541152 CCCAGGAAGTGCAAAGGGTTGGG + Intergenic
1014167265 6:118239345-118239367 CCCAGAATGTTCATAGAGGTAGG + Intronic
1014432608 6:121388550-121388572 CCCTGGATGTGCACAGGCCTTGG + Intergenic
1016342736 6:143080868-143080890 CCCAGGATGTGTGTAGGGATGGG + Intronic
1019415813 7:926111-926133 CCCAGGATGCTCAGAGGACTGGG + Intronic
1021626979 7:22603200-22603222 CACAGGATGGTGGCAGGGATAGG - Intronic
1022943944 7:35263565-35263587 CCCAGGCAGTTCATAGGGTTGGG - Intergenic
1026496899 7:70911393-70911415 CCAATGAGGTTCCCAGGGATTGG + Intergenic
1026917393 7:74129115-74129137 CTGAGGATTTTGACAGGGATTGG + Intergenic
1028418955 7:90610957-90610979 GGCAGGATGTTGACAGGGAGTGG - Intronic
1028588055 7:92470597-92470619 CCCAGGATGTATCTAGGGATGGG + Exonic
1030208836 7:106976668-106976690 CCCAGGACCTTCACAGGCATAGG + Intergenic
1030898070 7:115086135-115086157 CCTAGGATGTGAAGAGGGATAGG - Intergenic
1031471831 7:122176049-122176071 CCCAGGATGTGTCTAGGGATGGG - Intergenic
1031521745 7:122775723-122775745 TCCAGGAAGGTGACAGGGATTGG - Intronic
1032716734 7:134515219-134515241 CCCAGGACTTTCTAAGGGATGGG + Intergenic
1035260664 7:157659449-157659471 GGGAGGATGGTCACAGGGATGGG + Intronic
1035566141 8:642807-642829 CCCAGGATGTCTACAGGACTGGG + Intronic
1035681219 8:1489679-1489701 ACCAAGATGCTCACAGCGATGGG - Intergenic
1036787060 8:11695054-11695076 GTCACGATGTTCACATGGATGGG - Intronic
1041801607 8:61806622-61806644 CCCAGAAAAATCACAGGGATAGG - Intergenic
1041909825 8:63077366-63077388 CCCAGGAAGTGCAAAGGGTTGGG + Intronic
1045444268 8:102243727-102243749 CCCAGGATGTTCAAAGTTATTGG + Intergenic
1046336471 8:112795246-112795268 CCCAGGGTGTACTAAGGGATTGG + Intronic
1048044521 8:130760541-130760563 GCCAGGCTGTTCAGAGGAATTGG + Intergenic
1049927364 9:422282-422304 CCCAGGATAATCAAAGGTATAGG + Intronic
1050331851 9:4553901-4553923 CCCTGGATGTTCAAAGGGAAAGG - Intronic
1050711847 9:8474337-8474359 CCCAGGATGATGACAGAGTTTGG - Intronic
1051510399 9:17871117-17871139 CCAAAGATGTTAACAGGTATGGG - Intergenic
1051613225 9:18981721-18981743 CACAGCAGGCTCACAGGGATTGG + Intronic
1053020396 9:34690261-34690283 CTCACGATGTACCCAGGGATGGG + Exonic
1053393850 9:37754542-37754564 CTTAGGATGCTCACAGGGCTCGG + Intronic
1061823971 9:133246572-133246594 ACCTGTATGTTCACAGGGATGGG + Intergenic
1061825985 9:133258482-133258504 CCCTGGTTGTTCCCAGGGAAAGG + Intronic
1062622987 9:137430970-137430992 CCCAGGTCTTACACAGGGATGGG - Intronic
1189946828 X:46188480-46188502 CCCAGGATGTATCTAGGGATGGG - Intergenic
1192626900 X:72738400-72738422 CCGAAGATTTTCACCGGGATGGG + Intergenic
1196946668 X:120833320-120833342 CCCAGGAAGTGCAAGGGGATGGG - Intergenic
1197119173 X:122869847-122869869 CCCAGGCTATTCACTGGGCTGGG - Intergenic
1202026162 Y:20526094-20526116 CCCAGGTTTTACACAGGAATAGG + Intergenic