ID: 1063299718

View in Genome Browser
Species Human (GRCh38)
Location 10:4840612-4840634
Sequence GCCCAGGATGTTCACAGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 222}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063299718_1063299723 2 Left 1063299718 10:4840612-4840634 CCATCCCTGTGAACATCCTGGGC 0: 1
1: 0
2: 2
3: 23
4: 222
Right 1063299723 10:4840637-4840659 CAGCCACATGAAGCTGCTGTGGG No data
1063299718_1063299726 10 Left 1063299718 10:4840612-4840634 CCATCCCTGTGAACATCCTGGGC 0: 1
1: 0
2: 2
3: 23
4: 222
Right 1063299726 10:4840645-4840667 TGAAGCTGCTGTGGGGTCCTTGG No data
1063299718_1063299724 3 Left 1063299718 10:4840612-4840634 CCATCCCTGTGAACATCCTGGGC 0: 1
1: 0
2: 2
3: 23
4: 222
Right 1063299724 10:4840638-4840660 AGCCACATGAAGCTGCTGTGGGG No data
1063299718_1063299722 1 Left 1063299718 10:4840612-4840634 CCATCCCTGTGAACATCCTGGGC 0: 1
1: 0
2: 2
3: 23
4: 222
Right 1063299722 10:4840636-4840658 TCAGCCACATGAAGCTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063299718 Original CRISPR GCCCAGGATGTTCACAGGGA TGG (reversed) Intronic
900469859 1:2848414-2848436 GCCCAGGAGGTACCCAGAGAGGG + Intergenic
900563854 1:3322819-3322841 CCCCAGGATGGGGACAGGGAGGG + Intronic
900752595 1:4408134-4408156 GCTGATGATGTTGACAGGGAAGG - Intergenic
905292099 1:36928830-36928852 GATCAGGATGTTCTCAAGGAAGG + Intronic
906097528 1:43234464-43234486 GCCCAGGAGATTCTCAGTGAGGG - Intronic
906700962 1:47857652-47857674 GCCCAGGCTGGGCACAGAGAAGG + Intronic
907109257 1:51911702-51911724 GACCAGAATTTACACAGGGATGG + Exonic
909282271 1:73770701-73770723 GCCCAGGCTGTTCATGCGGAGGG - Intergenic
912935570 1:114001531-114001553 GGCCAGGATTTACTCAGGGAAGG - Intergenic
912947227 1:114095474-114095496 GCCCAGCCTGGTAACAGGGATGG + Intronic
912949569 1:114111547-114111569 GTCCAGGATGGTCAGAGGGATGG - Intronic
915280838 1:154821118-154821140 ACCCAGGAAGGTCACAGGGCTGG + Intronic
915637734 1:157198300-157198322 CCCCAGGATGTTTACAGGCAGGG + Intergenic
915670704 1:157486428-157486450 CCCCAGGATGTTCACAGGCAGGG - Intergenic
915900194 1:159841183-159841205 GCCCAGGATGTGCACAGCTGTGG + Exonic
915913808 1:159929696-159929718 GGCCAGGATGCTCACAAGGACGG + Exonic
917629595 1:176879095-176879117 GGCCAGCATGGTCACAGGGCTGG + Intronic
921189674 1:212699083-212699105 GACCAGGTTGGCCACAGGGACGG - Intronic
921740389 1:218678069-218678091 TCCCACAATGTGCACAGGGAAGG + Intergenic
922122407 1:222685701-222685723 GCCAAGGTTATTTACAGGGAGGG + Intronic
922620623 1:226985967-226985989 GCCCAAGGTGGTCAGAGGGACGG - Intronic
922684164 1:227626392-227626414 TCCCAGGATGTATCCAGGGATGG + Intronic
923043257 1:230334671-230334693 CTCCAGCATGTCCACAGGGAGGG - Intronic
923572630 1:235129886-235129908 TCACAGGATATTTACAGGGAAGG + Intergenic
923786258 1:237071771-237071793 GCCCAGGCTGTGCACACCGAGGG + Intronic
1063299718 10:4840612-4840634 GCCCAGGATGTTCACAGGGATGG - Intronic
1063971318 10:11383036-11383058 GACCAGGGTGTTCACATAGATGG - Intergenic
1064279932 10:13942305-13942327 TCCCAGGCAGTACACAGGGAGGG - Intronic
1065941639 10:30569575-30569597 GTCCAGGATGTTGACAGTGGAGG - Intergenic
1065963869 10:30755051-30755073 TCCCAGGAGGAGCACAGGGATGG - Intergenic
1067173185 10:43924124-43924146 GGGCAGGATGTTCCCAGAGAGGG + Intergenic
1067705595 10:48604587-48604609 GCCCAGGAGTTTCACGAGGAAGG + Intronic
1068287626 10:54961357-54961379 ACCCAGGATGTTCATGTGGAGGG - Intronic
1069751786 10:70749721-70749743 GCCCAGAAGGCTCACTGGGAAGG + Intronic
1070206802 10:74272350-74272372 GCCCAGGAGGTTGACATGCAGGG - Intronic
1070428752 10:76315661-76315683 GCCCAGGCTGTTCACGTTGAGGG - Intronic
1070755173 10:78987626-78987648 GCCCAGGATGGACCCAGGGCTGG + Intergenic
1070793533 10:79203681-79203703 GCCCAAGATGGACCCAGGGAGGG - Intronic
1071841352 10:89475151-89475173 GGCCAGGATGTTAACTGGGGTGG - Intronic
1073444715 10:103573855-103573877 GCCCAGGAAGGTTTCAGGGAGGG - Intronic
1073601605 10:104851439-104851461 GCTCAGGCTGTGGACAGGGATGG - Intronic
1074158940 10:110821491-110821513 GCCCAGGATTTCCCCAAGGAAGG + Exonic
1075397994 10:122141554-122141576 CCCCAGGGTGTTCTCAGAGATGG + Intronic
1077098207 11:808974-808996 GCCCGGGATATTGGCAGGGATGG + Intronic
1078032062 11:7762654-7762676 GCCCAGCACCTTCACAGGAATGG - Intergenic
1081377133 11:42373467-42373489 GCTGTGGATGTTCACAGTGAGGG + Intergenic
1082160531 11:48883859-48883881 GCCCCTGCTGTGCACAGGGATGG + Intergenic
1082161835 11:48896547-48896569 GCCCCTGCTGTGCACAGGGATGG - Intergenic
1082236142 11:49821667-49821689 GCCCCTGCTGTGCACAGGGATGG + Intergenic
1082609645 11:55281587-55281609 GCCCCTGCTGTGCACAGGGATGG + Intergenic
1082657041 11:55868941-55868963 GCCCCTGCTGTGCACAGGGATGG - Intergenic
1084213573 11:67634881-67634903 GCCCAGGATCTTCACCTGGAAGG + Exonic
1084644882 11:70450690-70450712 TCCCAGGATGTTCACAGAAAAGG - Intergenic
1084718501 11:70889288-70889310 GCCCAGGAACTTCAGAGGCAAGG + Intronic
1089958977 11:122599097-122599119 GCCCAGGAAGGACACAGAGAAGG + Intergenic
1090941772 11:131393541-131393563 ACCCAGGATGGGCACAGGGAAGG - Intronic
1091327529 11:134702073-134702095 GCCCAGGAGGGACACAGGCAGGG + Intergenic
1091983043 12:4881994-4882016 GCCCAGAATGTTACCAGGGGAGG + Intergenic
1092901935 12:13067994-13068016 GCCAAGGATAATCACAGGGAAGG - Intronic
1093525753 12:20102247-20102269 GCCCAGGCTGTTCATACAGAGGG + Intergenic
1096043762 12:48543864-48543886 GCCCAGAAGGTTAGCAGGGAGGG + Intergenic
1096192628 12:49630496-49630518 ACCCAGGATGGGCACAGAGATGG - Intronic
1096688252 12:53303365-53303387 CCCCAGGATGTAGACAGGGGAGG - Intronic
1098990914 12:77064740-77064762 GCCCAGGATGTGCTTAGAGAAGG - Intronic
1102031453 12:109742248-109742270 GCCGTGCATGTGCACAGGGAGGG - Intronic
1102885772 12:116520507-116520529 GCCCTGGCTGTTCCCAGGGCTGG + Intergenic
1105728323 13:23187118-23187140 GCCCAGAATGGTGGCAGGGAGGG - Intronic
1107022650 13:35767200-35767222 ACCCTGGATGTTCACAGGGTGGG - Intergenic
1108569017 13:51730922-51730944 GCCCAGCATGGTCTCAGTGATGG - Intronic
1110308212 13:74015510-74015532 GCCCATGAGTTTCACAGGGTTGG + Intronic
1113545664 13:111147600-111147622 GTCCAGGGTGTTCTCAAGGATGG - Intronic
1113574717 13:111387108-111387130 TCCCAGGGTGTCCACAGTGATGG + Intergenic
1114653720 14:24303321-24303343 GCCCAAGGAGTTCACAGGAATGG + Intronic
1115450787 14:33544648-33544670 GCCCAGGAAGTCCACAGTCAAGG - Intronic
1119976357 14:79028706-79028728 GGTTAGGATGTTGACAGGGAAGG + Intronic
1121017966 14:90559935-90559957 GCCCAGGATGGTGGCAGGAAGGG - Intronic
1121412472 14:93757480-93757502 GACCAGAATGTTCTCAGAGATGG + Intronic
1121469985 14:94145069-94145091 GGCCAACATGTTCACAGGGCTGG + Intergenic
1122092881 14:99351760-99351782 GCCCAGGGTGTGAAGAGGGAAGG - Intergenic
1122235667 14:100329572-100329594 GACCACCATGTTGACAGGGAAGG - Exonic
1122569572 14:102686370-102686392 GCGCAGGATGTTCACACTGGGGG - Intronic
1123114408 14:105887843-105887865 GCCCATGAGGTTCTCAGGAAGGG + Intergenic
1123118617 14:105906499-105906521 GCCCATGAGGCTCTCAGGGAGGG + Intergenic
1123120842 14:105916124-105916146 GCCCATGAGGCTCTCAGGGAGGG + Intergenic
1123403556 15:20007697-20007719 GCCCATGAGGTTCTCAGGGAGGG + Intergenic
1123512892 15:21014342-21014364 GCCCATGAGGTTCTCAGGGAGGG + Intergenic
1123773404 15:23553069-23553091 GACCAGGATGTTGACCAGGATGG - Intergenic
1124514542 15:30355241-30355263 GCCCAGGTCGTTCTCAGAGAGGG + Intergenic
1125446570 15:39764404-39764426 TCCCAGGAAGTCCACTGGGATGG - Intronic
1129906593 15:79191964-79191986 TCCCAGGATGTGCACAAGGACGG + Intergenic
1130230185 15:82091109-82091131 GCCAAGGTTGTTCACAGGTGTGG - Intergenic
1132744834 16:1432260-1432282 GCCCAGGATGGTGACTGGGTGGG - Intergenic
1133916688 16:10115486-10115508 CCCCAGGGTGTGCACATGGATGG - Intronic
1134453752 16:14379187-14379209 GCCCAGGAGGCTCACTGGGCAGG - Intergenic
1134610709 16:15605896-15605918 GCCCAGGATGATGAAAGGGGTGG - Intronic
1135173635 16:20208964-20208986 GCCCAGGCTCTGCCCAGGGATGG - Intergenic
1136060485 16:27723097-27723119 GCCCTGCGTGTTCACAGGCATGG + Intronic
1136710648 16:32234148-32234170 GCACAGGATGTTCCCAGGACTGG - Intergenic
1136757263 16:32695263-32695285 GCACAGGATGTTCCCAGGACTGG + Intergenic
1136810845 16:33175112-33175134 GCACAGGATGTTCCCAGGACTGG - Intergenic
1136817321 16:33285192-33285214 GCACAGGATGTTCCCAGGACTGG - Intronic
1136823884 16:33341721-33341743 GCACAGGATGTTCCCAGGACTGG - Intergenic
1137526731 16:49242913-49242935 GCCCAGACTGTCCCCAGGGAAGG - Intergenic
1139287948 16:65832174-65832196 TCCCAGGATGTTGAACGGGAGGG - Intergenic
1140112883 16:72018597-72018619 GACCAGGAGGGCCACAGGGAGGG - Intronic
1141646539 16:85370841-85370863 GCCCACGGAGTTGACAGGGAAGG + Intergenic
1141792397 16:86245576-86245598 GCCCTGGCTGCTCTCAGGGAAGG + Intergenic
1142417932 16:89953309-89953331 GCCCAGGAAGTTAAGTGGGAGGG + Intronic
1203059413 16_KI270728v1_random:955614-955636 GCACAGGATGTTCCCAGGACTGG + Intergenic
1142686125 17:1577906-1577928 GCCCTGGCTGCTCACTGGGAAGG - Intronic
1143650148 17:8258246-8258268 GCACAGGATGGCTACAGGGAGGG + Intronic
1144201892 17:12949278-12949300 GCCATGGAGGCTCACAGGGAAGG + Intronic
1146259864 17:31414317-31414339 TCCCAGGAAGCTCCCAGGGAAGG - Intronic
1147185447 17:38710990-38711012 TCCCAGGTTGTCCACAAGGATGG + Intronic
1147332091 17:39705285-39705307 GCCCAGGGTCTCCACAGGGCTGG - Intronic
1148447261 17:47745134-47745156 GCCCTGGAGGCTCAGAGGGACGG + Exonic
1149642661 17:58214046-58214068 ACCCAGGATGATAACAGGAAGGG + Intronic
1151483350 17:74383434-74383456 ACACAGGATGCTCACGGGGAGGG - Intergenic
1152336883 17:79703725-79703747 GCCAAGGCTGTCCACAGGGATGG + Intergenic
1152471194 17:80490921-80490943 GCACAGAATGTTGGCAGGGAGGG + Intergenic
1153027733 18:686776-686798 GCCAAGGAGGCGCACAGGGAGGG - Intronic
1153299727 18:3582122-3582144 GCCCAGGATGCCTACATGGACGG - Exonic
1153424040 18:4943756-4943778 GCCCAGATTCTTCAAAGGGAAGG + Intergenic
1155551914 18:26973736-26973758 GCCCAGCATGCTCAGAGTGACGG - Intronic
1156504786 18:37582994-37583016 GTCCAGGTGGTTCTCAGGGAGGG - Intergenic
1160663869 19:313781-313803 GCCCAGGAGGAGCACAGGGATGG - Intronic
1161785406 19:6322038-6322060 CCCCAGGATGCTTGCAGGGAAGG + Intronic
1162551228 19:11359587-11359609 TCCCTGGGTGTGCACAGGGAAGG - Exonic
1163075372 19:14886338-14886360 GCCAAGGAAGTCCACGGGGAAGG - Intergenic
1163437046 19:17302184-17302206 CCACAGGGTGTCCACAGGGAAGG + Intronic
1163860949 19:19742596-19742618 GCCCAGGAGACACACAGGGAAGG - Intergenic
1165245721 19:34497452-34497474 TCCCATGATGGACACAGGGACGG + Intronic
1165903913 19:39181814-39181836 GCCCAGGAGGGGCACAGGGATGG + Intronic
1166151947 19:40881305-40881327 ACCCAGGATGTCCTCAGAGATGG + Intronic
1166178219 19:41089353-41089375 ACCCAGGATGTCCTCAGAGATGG - Intronic
1166802268 19:45465555-45465577 GGCCAGGCTGTGCACTGGGAGGG + Intronic
1167106376 19:47432153-47432175 TCCCAGGGTGTTACCAGGGATGG + Exonic
1202713948 1_KI270714v1_random:32210-32232 AGCCAGGATGGACACAGGGAAGG - Intergenic
925535165 2:4908905-4908927 GCCCAGGATGAGGAAAGGGAAGG - Intergenic
926971450 2:18471344-18471366 GCTGAGGATGTGCTCAGGGAAGG + Intergenic
927148184 2:20180385-20180407 ACCCCGGATGCTCCCAGGGAGGG - Intergenic
928317056 2:30254788-30254810 GGCCAGGCTCTTCACAGGGCAGG + Intronic
929245282 2:39695581-39695603 GGCTAGGATGGTCACAGAGATGG + Intronic
929464621 2:42133456-42133478 GCCCAGGCTGCTCACACGCATGG - Intergenic
932163722 2:69486581-69486603 TCCCAGGACTCTCACAGGGAAGG + Intronic
934660652 2:96141852-96141874 GCCCAGGATGGTGAGGGGGATGG + Intergenic
934769380 2:96898284-96898306 GTCCAGGATGTCCAGAGGCAAGG + Intronic
935133091 2:100275773-100275795 TCCCAGCATGTTGACAGGCAGGG - Exonic
937150029 2:119679976-119679998 GACCAGGGTGTTAACAGGGTTGG + Intronic
937334715 2:121055032-121055054 TTCCATGATGTTCACAGGGAGGG + Intergenic
937370865 2:121296388-121296410 GCCCAGGCTGTTCACACTAAGGG + Intergenic
938108791 2:128550878-128550900 GCCCCGATTCTTCACAGGGAGGG + Intergenic
941613405 2:167689739-167689761 GACCAGGATGTCTACAGAGAAGG + Intergenic
941619661 2:167762389-167762411 TCCCAGCATTTTCATAGGGATGG - Intergenic
941930141 2:170930223-170930245 GCCCAGGCCGTTCATAGGTAGGG - Intronic
942085794 2:172442503-172442525 GCCATGGATGTTCATAGGGAAGG + Intronic
942327448 2:174788008-174788030 GCCCCATATGTTCGCAGGGAGGG - Intergenic
947769917 2:232662408-232662430 GCCCAGCACGTTCACAGGGAAGG - Intronic
948777604 2:240297742-240297764 GCCCAGGCTGGGCACAGAGAAGG - Intergenic
1170357622 20:15509464-15509486 GGCCAGGATGTTCCTAGGGTTGG + Intronic
1171978546 20:31610800-31610822 GGCCAGGAGGAGCACAGGGAGGG + Intergenic
1172122654 20:32607944-32607966 GCCCAGGAGGGGCACAGTGAGGG + Intronic
1176024440 20:62978585-62978607 GGCCAGGATGGTCCCAGGCAAGG + Intergenic
1176125033 20:63471495-63471517 GCCCGGGATGTGCACGGGGGCGG + Intronic
1178922293 21:36746698-36746720 GCCCAAGATGTTCACGGGTATGG - Intronic
1179811252 21:43871683-43871705 GAACAGGAACTTCACAGGGAAGG - Intronic
1179911514 21:44451602-44451624 GCCCAGGATGTTCTCACGATCGG + Intergenic
1180919813 22:19515920-19515942 TCCCAGGATGTGCACCAGGATGG - Intronic
1183152399 22:36048062-36048084 GCCCTTGATGTTCACTTGGAAGG - Intergenic
1184185434 22:42861748-42861770 GCCCAGGATGCTCAAAGGGTGGG - Intronic
1184350032 22:43937399-43937421 GCCCAGGCTGTACACATGGAAGG - Intronic
1185335253 22:50268358-50268380 GCCCAGGAGGCTCACAGAGGGGG + Intronic
949986416 3:9544786-9544808 GAACAGGATGATCACAGGCATGG - Intronic
950326887 3:12119294-12119316 GAGCTGAATGTTCACAGGGAAGG - Intronic
951993238 3:28699387-28699409 GCCCAGAAAGTTCCCAGAGACGG + Intergenic
953308164 3:41849704-41849726 GTGCAGGATGTTAATAGGGAAGG + Intronic
953490800 3:43348475-43348497 CCGCTGGATGTTCACAGAGATGG - Exonic
954123771 3:48516839-48516861 GCCCATGATGTTCTGAGGCATGG + Intergenic
956747063 3:72318663-72318685 GCCCAGGAAAGCCACAGGGACGG + Intergenic
957486670 3:80870875-80870897 GCCCAGGCTGTTCATACTGAGGG - Intergenic
963554007 3:146762490-146762512 ACCCAGGCTATTCACAGGCATGG + Intergenic
966883018 3:184360569-184360591 GCCCAGGAAGGTGGCAGGGAGGG - Intronic
967817080 3:193808713-193808735 GCCCAGCATGTTTGCAGGTATGG - Intergenic
968027680 3:195456253-195456275 ACCAAGGATGCACACAGGGAAGG - Intergenic
968350105 3:198046601-198046623 GCCCAGGAGACACACAGGGAAGG + Intergenic
968943092 4:3649324-3649346 CGCCAGGATGAACACAGGGAAGG - Intergenic
969094998 4:4726011-4726033 TCACAGAGTGTTCACAGGGAAGG + Intergenic
970517634 4:16849195-16849217 TCCCAAGATGCTCACAGGGCTGG + Intronic
971029678 4:22622584-22622606 GCCCAGCATGCTCAGAGTGATGG - Intergenic
973223503 4:47755609-47755631 GTCCAGGATTTTAACAGTGATGG + Intronic
975178593 4:71316307-71316329 GTCCAGAATGTTCAGAGGGAGGG - Intronic
975770399 4:77714756-77714778 GCTCAGGAATTTCACAGGTAAGG + Exonic
975776904 4:77797129-77797151 GCCAAGGATATTCACTGGGGAGG + Intronic
976449683 4:85174082-85174104 GCCCAGGGTTTTCACAGTGGAGG - Intergenic
977487350 4:97665710-97665732 GCCCAGGCTGTTCATGCGGAGGG + Intronic
977702875 4:100040078-100040100 GCCCAGAAGGAGCACAGGGAAGG - Intergenic
980705693 4:136490263-136490285 CTCCAGGATGTAGACAGGGAAGG + Intergenic
981748867 4:148074652-148074674 GCCCAGGATGTACTGAGGAATGG + Intergenic
982925455 4:161331656-161331678 CCCCAGGTTGTTCAGATGGAAGG + Intergenic
983827235 4:172278504-172278526 GCCCAGGATGATGACCAGGAGGG - Intronic
984861742 4:184246467-184246489 GCCCAGGATGGGCGTAGGGATGG + Intergenic
985111912 4:186555234-186555256 GCCCAGGATGTCCACCACGATGG + Exonic
985146661 4:186900831-186900853 GCCCAGAATCATCACTGGGACGG + Intergenic
990019172 5:51104154-51104176 GCCAGAGAAGTTCACAGGGAAGG - Intergenic
990359530 5:55004509-55004531 GCCCAGAGTGATGACAGGGATGG - Intronic
991269237 5:64759694-64759716 GCAAAGGATGTTCACAGAAACGG + Intronic
991377610 5:65982899-65982921 GGTCAGGATGTTGACTGGGAAGG + Intronic
993811617 5:92485920-92485942 GGGCAACATGTTCACAGGGATGG - Intergenic
995271767 5:110227941-110227963 GCCCAAGATGTTGACTGGGCTGG - Intergenic
999077596 5:148811742-148811764 CCCAAGGATATTCACAGTGATGG - Intergenic
999732167 5:154482950-154482972 GCCCAGCCTGCTCCCAGGGATGG + Intergenic
1001293886 5:170485419-170485441 GCCCAGGGTGTGGACGGGGAGGG + Intronic
1002454055 5:179336217-179336239 GTCCAGGGTGTTGACAGTGAGGG - Intronic
1002690549 5:181046843-181046865 CCCCAGGAAGTTGACAGGTAGGG + Intronic
1003202819 6:3977979-3978001 GTTCAGGATGTTAACAGTGAGGG - Intergenic
1017725471 6:157273784-157273806 CCCCAGGAGGCTCACAGGGAGGG + Intergenic
1019412004 7:910840-910862 GTCCAGGCCCTTCACAGGGACGG - Intronic
1019524168 7:1473296-1473318 GGCCAGGACGCTCAGAGGGAGGG + Intronic
1024185717 7:46946090-46946112 GCCCAGAGAGGTCACAGGGAAGG + Intergenic
1024278480 7:47698362-47698384 GCCCAGGATGTGCCCAGGGCAGG + Intronic
1026929299 7:74215123-74215145 AGACAGGATGTTCAGAGGGAGGG - Intronic
1030521294 7:110601419-110601441 CCCCAAGATGTTCCCAGGAAAGG + Intergenic
1035242177 7:157539461-157539483 GACCAAGATGATCACATGGAAGG - Exonic
1035662966 8:1361082-1361104 CCCCAGGCTGTTCACAGTGATGG + Intergenic
1036787061 8:11695055-11695077 GGTCACGATGTTCACATGGATGG - Intronic
1037929397 8:22868833-22868855 GCCCAGGATGCCCAGATGGAAGG - Intronic
1041168140 8:55112004-55112026 CCCCAGGGAGTTCTCAGGGAAGG - Intronic
1043737779 8:83768930-83768952 GCCCAGGCTATTCACGTGGAAGG + Intergenic
1043798683 8:84579070-84579092 GCCCAGGCTGTTCATGTGGAAGG + Intronic
1049225478 8:141448690-141448712 GTCCAGAATGTTCTCAGGGTGGG + Intergenic
1049545475 8:143228747-143228769 GCCCCGGAGGTTTCCAGGGAGGG - Intergenic
1049694071 8:143975140-143975162 GCCAAGGAGGTGCACAGGCAAGG + Intronic
1053165397 9:35840810-35840832 GCCCAGAATGCTCAGGGGGAGGG + Intronic
1055513815 9:77018467-77018489 GCGCAGGCTGTTCGCCGGGAGGG - Intergenic
1056532889 9:87502553-87502575 GCCCAGGAGGCTCACAGGTTAGG - Intronic
1056853004 9:90100081-90100103 GCAAAGGATGTTCCCTGGGAAGG + Intergenic
1056922979 9:90808549-90808571 GACCTGGATGTGCACAGGGCAGG + Intronic
1057346939 9:94259595-94259617 GCCCAGTATGTTGACCTGGAGGG + Intronic
1058853477 9:109036332-109036354 GCCCAGTATGTCCCCAGGAATGG + Exonic
1061823970 9:133246571-133246593 CACCTGTATGTTCACAGGGATGG + Intergenic
1061907722 9:133707446-133707468 GCCCAGAGTGGTCACAGGGCTGG - Intronic
1061959219 9:133979525-133979547 ACAGAGGATGTTGACAGGGAGGG + Intronic
1062715922 9:138010034-138010056 GGCCAGGTTGTCCACAGCGATGG - Exonic
1186459888 X:9739805-9739827 CCCCAGGATGCCCACAGGGCTGG + Intronic
1186853758 X:13606094-13606116 GCCCTGGCTGTTCTCAGGCAGGG - Intronic
1188773443 X:34184010-34184032 GACCTGGAAGTGCACAGGGAAGG - Intergenic
1191595046 X:62934647-62934669 GCCCTGGATGTTTGCTGGGAAGG - Intergenic
1192626898 X:72738399-72738421 GCCGAAGATTTTCACCGGGATGG + Intergenic