ID: 1063299720

View in Genome Browser
Species Human (GRCh38)
Location 10:4840617-4840639
Sequence CTGAAGCCCAGGATGTTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 181}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063299720_1063299722 -4 Left 1063299720 10:4840617-4840639 CCTGTGAACATCCTGGGCTTCAG 0: 1
1: 0
2: 1
3: 17
4: 181
Right 1063299722 10:4840636-4840658 TCAGCCACATGAAGCTGCTGTGG No data
1063299720_1063299723 -3 Left 1063299720 10:4840617-4840639 CCTGTGAACATCCTGGGCTTCAG 0: 1
1: 0
2: 1
3: 17
4: 181
Right 1063299723 10:4840637-4840659 CAGCCACATGAAGCTGCTGTGGG No data
1063299720_1063299724 -2 Left 1063299720 10:4840617-4840639 CCTGTGAACATCCTGGGCTTCAG 0: 1
1: 0
2: 1
3: 17
4: 181
Right 1063299724 10:4840638-4840660 AGCCACATGAAGCTGCTGTGGGG No data
1063299720_1063299726 5 Left 1063299720 10:4840617-4840639 CCTGTGAACATCCTGGGCTTCAG 0: 1
1: 0
2: 1
3: 17
4: 181
Right 1063299726 10:4840645-4840667 TGAAGCTGCTGTGGGGTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063299720 Original CRISPR CTGAAGCCCAGGATGTTCAC AGG (reversed) Intronic
900293956 1:1939373-1939395 CTGGAGCGCAGGAGGTGCACAGG + Intronic
900529310 1:3144931-3144953 CTGAGGCCCTGGGGGTTCACTGG - Intronic
902318132 1:15639444-15639466 CTGAAACCCAGCATGTGCTCAGG - Intronic
902671508 1:17977691-17977713 CTGAAGCTCAGGCTTTTCTCAGG + Intergenic
903070494 1:20724685-20724707 CTGAGGCCCAGGGAGTTCACTGG - Intronic
904750724 1:32740415-32740437 CTGAGGCCCAGCATGGACACTGG + Intergenic
905442051 1:38001761-38001783 CTGAGCTCCAGGAGGTTCACTGG - Intronic
908386218 1:63644146-63644168 CTGAGACCCAGGATGTGCCCTGG + Intronic
912686113 1:111766667-111766689 CTGAAGCCCAGGAAGATGATTGG + Exonic
915649797 1:157301375-157301397 CTGCACCCCAGGATGTTCTGTGG - Intergenic
915670707 1:157486433-157486455 GACAACCCCAGGATGTTCACAGG - Intergenic
916512223 1:165482460-165482482 CTGAAGCCCGAGATGTTAGCTGG - Intergenic
916646818 1:166795051-166795073 CTGAAACTCAGGAAATTCACTGG - Intergenic
917485808 1:175453651-175453673 CTGGAGCCCAGGAGGAGCACAGG - Intronic
918781524 1:188705697-188705719 GTGGAGCACAGGATGTTCAAGGG - Intergenic
921165208 1:212502142-212502164 CTGAAGGGCAGGATTTCCACTGG - Intergenic
921585171 1:216937733-216937755 CTGAAACCCAGGATGTTGCAGGG + Intronic
921769447 1:219018197-219018219 CACAAGCCCAGGATGCTCACAGG + Intergenic
923555456 1:234997333-234997355 CTCAGGACCAGGATGTTCTCTGG - Intergenic
1063299720 10:4840617-4840639 CTGAAGCCCAGGATGTTCACAGG - Intronic
1067495078 10:46754368-46754390 CTGAGGCCCAGTATGGTCCCTGG - Intergenic
1067599577 10:47586028-47586050 CTGAGGCCCAGTATGGTCCCTGG + Intergenic
1067793136 10:49302458-49302480 CTGAAGCCAATGATTTCCACAGG - Intronic
1069729650 10:70602486-70602508 CTGAGGCCCAGGGTGGACACAGG + Intronic
1069824342 10:71246056-71246078 CTGAAGCTCAGGCTGTCCTCAGG + Intronic
1070700722 10:78599875-78599897 CTGAAGCCCAGGATGAAAAAGGG + Intergenic
1071651107 10:87393912-87393934 CTGAGGCCCAGTATGGTCCCTGG + Intergenic
1073598659 10:104824761-104824783 CTGATCCCCAGGAAATTCACTGG + Intronic
1076461495 10:130650235-130650257 CTGGAGCCCAGGCTGTTGCCAGG + Intergenic
1076679396 10:132163843-132163865 CTGATGGCAAGGATGTTCTCTGG + Intronic
1077018176 11:406160-406182 GTGAGGCCCAGGAAGTTCCCAGG + Intronic
1077555993 11:3226365-3226387 CTCCAGCCCAGGATCTGCACAGG - Intergenic
1079122365 11:17695334-17695356 ATGAATCCCAGGATCTTCGCAGG - Intergenic
1079566142 11:21885738-21885760 CTGTAGGCCTGGTTGTTCACTGG + Intergenic
1079659749 11:23022647-23022669 CTGATGCCCAGGAGGGTCACTGG - Intergenic
1079849495 11:25513174-25513196 CTGAATCAGAGGAAGTTCACAGG + Intergenic
1081619359 11:44609878-44609900 CTGAAGCACACGCTGGTCACTGG + Intronic
1084746565 11:71173867-71173889 TTGAAGCCCTGGATGTTCCTTGG - Intronic
1085027705 11:73246614-73246636 TTCAAGCCCATGATGTTCAGGGG - Intergenic
1085461323 11:76695610-76695632 CTGGAGCCCAGGAAGTGCAGTGG - Intergenic
1085681378 11:78578207-78578229 CTGAAACCCATGTTGTTCAAGGG - Intergenic
1086281523 11:85195065-85195087 CTGAAGCCCAGGAAGAACAAGGG + Intronic
1090541836 11:127714917-127714939 CTGAAGCCCAGAATTTAAACTGG + Intergenic
1091396355 12:156179-156201 CTGAAGCTCGGGATGTTCACAGG + Intronic
1093881200 12:24406186-24406208 CTGAAGCCCAAGAGGATCAACGG + Intergenic
1097307080 12:58081263-58081285 CTGCTGCCCAGAATGTTTACAGG + Intergenic
1097805149 12:63957296-63957318 CAGAAGCCCAGGAAGCTCACTGG - Intronic
1104703895 12:130928327-130928349 CTGAACCCCAGGATGTCACCTGG + Intergenic
1105951595 13:25234063-25234085 CTGAAGACCAGCATTTTCATAGG - Intergenic
1110567863 13:76974444-76974466 CGGAAGCCCAGGATTGCCACAGG + Intergenic
1113188040 13:107712470-107712492 CTGAAGCCCAGGATGGTGCATGG + Intronic
1113765932 13:112881251-112881273 CTGGGGCCCCGGATGTGCACGGG - Intronic
1115226000 14:31102965-31102987 CTGCTGCCCAGGATGGTGACTGG + Exonic
1117218642 14:53578819-53578841 CATAAGCCCAGGAAGTTCTCTGG + Intergenic
1117615088 14:57526774-57526796 CTGGAGCCCAGTAACTTCACTGG - Intergenic
1118456748 14:65951813-65951835 CTCAGGCTGAGGATGTTCACAGG + Intergenic
1119388628 14:74275373-74275395 CAGAAGCCCAGAATGCTCTCTGG - Intergenic
1121586105 14:95064206-95064228 ATGGAGCCCAGGCTGTTCAGTGG + Intergenic
1121783112 14:96635199-96635221 CTGAGACCCAGGTTCTTCACTGG + Intergenic
1124077540 15:26460613-26460635 CTGCAGTGCAGGATGTTGACTGG - Intergenic
1129141122 15:73598803-73598825 CAGAAGCCAAGGATGTTAACAGG + Intronic
1130819473 15:87479236-87479258 CTGGAACCCAGGAGATTCACTGG + Intergenic
1131058029 15:89387663-89387685 CTGAAGCACATGCTGTCCACTGG - Intergenic
1132319266 15:100913640-100913662 CTGTAGCCCAACATATTCACAGG + Intronic
1134258177 16:12628957-12628979 GTGAAGCCCATGATGTTGATTGG - Intergenic
1135422124 16:22312455-22312477 CTGTTGCCCAGGATATTCAGTGG - Intronic
1136710649 16:32234153-32234175 CTGTGGCACAGGATGTTCCCAGG - Intergenic
1136757262 16:32695258-32695280 CTGTGGCACAGGATGTTCCCAGG + Intergenic
1136810846 16:33175117-33175139 CTGTGGCACAGGATGTTCCCAGG - Intergenic
1136817322 16:33285197-33285219 CTGTGGCACAGGATGTTCCCAGG - Intronic
1136823885 16:33341726-33341748 CTGTGGCACAGGATGTTCCCAGG - Intergenic
1138208761 16:55145227-55145249 CTGAACCCCAGTTTGTTCTCAGG - Intergenic
1139658871 16:68406492-68406514 CTGAAGGCCAGGATGGTGCCTGG + Intronic
1141121498 16:81361904-81361926 CTTGAGCCCAGGAGGTTCATAGG - Intronic
1203059412 16_KI270728v1_random:955609-955631 CTGTGGCACAGGATGTTCCCAGG + Intergenic
1143660553 17:8322101-8322123 AGAAAGCCCAGGAGGTTCACTGG - Exonic
1143987005 17:10923518-10923540 CAGAAGCCAGGCATGTTCACAGG + Intergenic
1145293361 17:21567958-21567980 CTGAAGGACAGGATGGACACAGG - Intronic
1145386614 17:22417981-22418003 CTGAAGGGCAGGATGGACACAGG + Intergenic
1148772155 17:50073744-50073766 CTGCAGCTCAGGATGAACACTGG - Intronic
1152788270 17:82263621-82263643 TAGAAGCCCGGGATGGTCACTGG - Intronic
1152931677 17:83113313-83113335 CTGAGGCCCAGGGTGTCCCCTGG + Intergenic
1152996163 18:408154-408176 CTAAAGCCCATGATCTTCCCAGG - Intronic
1154009027 18:10559831-10559853 AGGAAGCCCAGGATGTTCTCAGG + Intergenic
1157740385 18:50087740-50087762 ATGAAGCCCAGAGCGTTCACTGG + Intronic
1157977068 18:52339917-52339939 CAGACGCTCAGGATGTTCGCAGG + Intergenic
1158502273 18:58013420-58013442 CTGATGCTCAGGATATTCTCAGG - Intergenic
1158528320 18:58235053-58235075 GAGAAGCCCAGAATGTTCCCAGG + Intronic
1160521716 18:79511794-79511816 CTGAAGCTCAGGACGTGCAGTGG + Intronic
1162637117 19:11977819-11977841 CTGTACTCCAGGATGGTCACAGG + Intronic
1162799008 19:13100969-13100991 CTGTGGCCCAGGCTGATCACTGG + Exonic
1163777848 19:19228341-19228363 CTGAAGCTCCTGATGTTCCCTGG - Exonic
1166310032 19:41957685-41957707 CTGAAGGCCAGGCTCTTCAGGGG - Intronic
925585045 2:5456870-5456892 CATAAGCCTAGGATTTTCACGGG + Intergenic
925886428 2:8397161-8397183 ATTCAGCCCAGGATGTCCACAGG + Intergenic
926902860 2:17774926-17774948 CTGAAGCCCAGAAAGCCCACTGG + Intronic
930883482 2:56298075-56298097 ATCAACCCCAGGAGGTTCACTGG - Intronic
931094286 2:58921738-58921760 CTGAGGCCCAGAGGGTTCACTGG + Intergenic
931617264 2:64172724-64172746 CTGAAAACCAGGATGGGCACAGG + Intergenic
931789970 2:65656159-65656181 ATGAAGCCCAGGTTCTTCATCGG + Intergenic
933409906 2:81912046-81912068 CTTAAGCCCAGGCTGTTCAAGGG + Intergenic
933707906 2:85305249-85305271 CTGGAGACCAGGCTGTGCACCGG - Exonic
933812025 2:86038709-86038731 ATGAAGCGCAGGATGTCCTCGGG + Exonic
937203098 2:120218421-120218443 ATGAAGCCCAGCAAGTTCACAGG - Intergenic
938324729 2:130390896-130390918 CTGAAACCCAGGAGGTTGGCTGG + Intergenic
941068552 2:160930430-160930452 GAGAAGACCAGGAAGTTCACAGG - Intergenic
942155118 2:173120373-173120395 CTGAAACCCAGGGGGTTCATGGG - Intronic
943550287 2:189330416-189330438 CTGAAAGCCCGGAGGTTCACAGG + Intergenic
944673879 2:202019064-202019086 CACAAGACCAGGATGTTCATGGG - Intergenic
945432382 2:209779199-209779221 ATGAGGCCCAGGAGGTGCACAGG - Intronic
947230854 2:227884888-227884910 CTGGGGCCCAGAATGTGCACTGG + Intronic
947437312 2:230083706-230083728 CTGGAGCCCAGGATGTGCAGAGG - Intergenic
947769919 2:232662413-232662435 CTGACGCCCAGCACGTTCACAGG - Intronic
948560484 2:238848246-238848268 CTGGTGCCCAGGCTGTCCACGGG - Exonic
1169641748 20:7759958-7759980 CTGAAGCCCAGCACAATCACAGG + Intergenic
1171102063 20:22393835-22393857 CTGGAGCCAGGGAAGTTCACTGG - Intergenic
1172276690 20:33683996-33684018 CTGAAGTCCAGAAAGTCCACAGG - Intronic
1172826197 20:37788617-37788639 CTGAAGCCCAGCATGGGCACAGG - Intronic
1175245880 20:57581658-57581680 CTGAGGCCCAGCAAGGTCACTGG + Intergenic
1179407717 21:41139087-41139109 CTGAAGCCCAGACAGTCCACAGG + Intergenic
1182251564 22:29004914-29004936 ATGAAGCCGAGCAGGTTCACGGG - Intronic
1183523267 22:38308925-38308947 CTGAAGGCCAGGATCTTAGCCGG - Intronic
1184185437 22:42861753-42861775 GTGTAGCCCAGGATGCTCAAAGG - Intronic
949396075 3:3615891-3615913 CTGAAGCCCAGTCTGTTCCTGGG - Intergenic
949693511 3:6667646-6667668 CTGTAGCCCAGGTTGTACCCAGG - Intergenic
953495925 3:43386882-43386904 CTGAAGCCTGGGATCTCCACTGG + Intronic
954640971 3:52097527-52097549 CTGGAGCCAAGGATGTCCAAGGG + Intronic
955094465 3:55783287-55783309 CTGAGGCCCAGGCTGGTTACTGG - Intronic
958468793 3:94492740-94492762 CTGCAGTGCAGGATGTTCACTGG - Intergenic
962676170 3:137760364-137760386 CTGAAGCCCACGCTGCTCTCAGG + Intergenic
962732208 3:138293729-138293751 CTGAGAGCCAGGTTGTTCACTGG + Intronic
963557386 3:146809963-146809985 GATAAGCCCATGATGTTCACAGG - Intergenic
967218522 3:187229846-187229868 CTGATGGCCAGGATCTTCAATGG - Intronic
967323909 3:188220154-188220176 CTGAAACCCACCATGTTGACAGG + Intronic
969297427 4:6278163-6278185 CTGGGGCCCTGGGTGTTCACAGG + Intronic
969297443 4:6278254-6278276 CTGAGGCCCTTGGTGTTCACAGG + Intronic
969614973 4:8247036-8247058 CTGAAGCCCAGGCTGTCCTGGGG - Intergenic
969901389 4:10353884-10353906 TTGAACCCCAGGATCTTCCCTGG - Intergenic
970039539 4:11780342-11780364 CTGAAGGCCAGGATGGGTACAGG - Intergenic
970824392 4:20254111-20254133 CTCAACCCCAGGATGTGCATGGG - Intronic
974874856 4:67691043-67691065 TTGAAACCCATGTTGTTCACGGG - Intronic
976115827 4:81725124-81725146 TTCAAGCCCTGGTTGTTCACAGG + Intronic
978362477 4:107946177-107946199 CTGAAAATCAGGATGTTGACAGG + Intronic
982061925 4:151613495-151613517 TTCAAGCCCAGGAGGTTAACGGG - Intronic
986030676 5:3890083-3890105 CTGAGACCCGGAATGTTCACTGG + Intergenic
987647154 5:20688898-20688920 ATGAAGTCCAGGATATTCACTGG + Intergenic
988365546 5:30294013-30294035 CTAAAGCCCAAGCTGTACACAGG + Intergenic
994187504 5:96831463-96831485 CTTCAGCCCATGATGTTCAAGGG + Intronic
994455239 5:99997460-99997482 CTGAAGCCCACGTTGTTCTTAGG - Intergenic
998197004 5:140082507-140082529 CTGAAGCCCATGGTCTTAACTGG + Intergenic
998589572 5:143463372-143463394 CTGAAGGCTAAGATGTTCAAGGG + Intergenic
1003429673 6:6027778-6027800 CTGAGGCCAAGAATGTTCTCTGG - Intergenic
1003829664 6:9993838-9993860 CTGAGAACCAGGGTGTTCACTGG - Intronic
1004064357 6:12228459-12228481 CTGACCCCCAGGATGGTTACTGG - Intergenic
1005406290 6:25491299-25491321 CTGAACCACAGGATGGTCTCAGG - Intronic
1005821338 6:29602193-29602215 TTGAAGCCCATTCTGTTCACAGG + Intronic
1011656324 6:89555207-89555229 CTAAAGCCCAGGAATTTCTCTGG + Intronic
1014822833 6:126011923-126011945 CTGAAGCTCAGTAGGTTCACAGG - Intronic
1016222937 6:141698152-141698174 CTGAAGCCTTGGATGATCACTGG + Intergenic
1018214652 6:161514910-161514932 CTGAAGCCAAGGGTGTCCCCTGG + Intronic
1020231453 7:6322136-6322158 CTTCTGCCAAGGATGTTCACAGG - Intergenic
1022374005 7:29796640-29796662 CTGAAGGATAAGATGTTCACCGG + Intergenic
1023425221 7:40028991-40029013 CTCAAACCCATGATGTTCAAGGG - Intronic
1025244721 7:57308565-57308587 CTGAGGCCCAGGAGAGTCACAGG + Intergenic
1025582343 7:62736340-62736362 CTGAAGCCCAGGAAGAACAAGGG + Intergenic
1027396901 7:77766122-77766144 CTGAAGCCCAGAAAGTTTAAAGG - Intronic
1027953638 7:84852068-84852090 ATGAAGCCCATGATTTTCAGTGG + Intergenic
1030165860 7:106554259-106554281 CAGAGGCCCAGGATGGGCACAGG + Intergenic
1032350489 7:131158468-131158490 TTGAAGCACAGTATGTACACAGG - Intronic
1034546159 7:151790851-151790873 CTGAGGCCGAGGAGGTTCAAAGG + Intronic
1035089638 7:156296769-156296791 ATGAAGCCTAACATGTTCACAGG - Intergenic
1035425009 7:158764809-158764831 TTGAAGCTCAGGATCTTCAGGGG - Exonic
1035662669 8:1359558-1359580 CTGAAGCCCAGGCCGCTCAGCGG + Intergenic
1036499131 8:9297243-9297265 AAGAAGCCCATGAGGTTCACAGG - Intergenic
1038400392 8:27280080-27280102 CTGGAGTCCAGGATCTGCACGGG - Intergenic
1038549653 8:28455613-28455635 CTGAAGCTCAGGCTGTTCAGGGG - Intronic
1039407339 8:37324892-37324914 CCCAGGCCCAGGATGTGCACTGG + Intergenic
1041973257 8:63767792-63767814 TAGAAGCCCAGGTTCTTCACTGG + Intergenic
1043564119 8:81528844-81528866 GAGAAGACCAGGATGTCCACAGG + Intronic
1044757628 8:95481436-95481458 ATGAACCCCAGGATGTTTCCAGG + Intergenic
1049008828 8:139874042-139874064 CTGAAGGCCAGGCTGGCCACAGG + Intronic
1049147630 8:141013286-141013308 CTAAACCCCAGGTTGCTCACAGG + Intergenic
1049233509 8:141496337-141496359 CAGGAGCACAGGATGTTCATGGG - Intergenic
1049416285 8:142497135-142497157 CTGAGGCCCAGAGTGCTCACTGG + Intronic
1053158579 9:35797321-35797343 CAGAAGCCCAGGCTGGTCAATGG + Intronic
1055466347 9:76570401-76570423 CTGAAGCCCAAGATGTGGAAAGG - Intergenic
1057301347 9:93886818-93886840 TTCAAGCCCATGATGTTCAAGGG + Intergenic
1058726677 9:107811291-107811313 TTGAAGCTCAGGAGGTACACCGG + Intergenic
1059232155 9:112730693-112730715 TTCAAGCCCATGATGTTCAAGGG + Intergenic
1059498532 9:114730857-114730879 CTGAGGCCCAGGCTGTTGGCTGG + Intergenic
1061224053 9:129270320-129270342 TTGATCACCAGGATGTTCACTGG - Intergenic
1061505381 9:131028962-131028984 CTGAAGTCCAGGGTTTTTACTGG + Intronic
1062321679 9:135993302-135993324 TTGAGGCCCAGGATGTCCAGCGG + Intergenic
1190232829 X:48595546-48595568 CTGAAGCCCAGGGAATTCAAGGG - Intronic
1190395493 X:49977771-49977793 CAGAAGCCCAGGCTGTACACAGG + Intronic
1192784427 X:74322971-74322993 CTCAGGCCCAGGATGTTGCCTGG + Intergenic
1192804205 X:74495337-74495359 CTCAGGCCCAGGATGTTGCCTGG - Intronic
1193851449 X:86542560-86542582 CTGCGGGCCAGGATGTTCAAGGG - Intronic
1199553633 X:149082056-149082078 CTGGGGCCCAGGATCTCCACTGG + Intergenic
1199829855 X:151538627-151538649 CTGGAGCCCAGCATATGCACTGG - Intergenic