ID: 1063299723

View in Genome Browser
Species Human (GRCh38)
Location 10:4840637-4840659
Sequence CAGCCACATGAAGCTGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063299718_1063299723 2 Left 1063299718 10:4840612-4840634 CCATCCCTGTGAACATCCTGGGC 0: 1
1: 0
2: 2
3: 23
4: 222
Right 1063299723 10:4840637-4840659 CAGCCACATGAAGCTGCTGTGGG No data
1063299713_1063299723 14 Left 1063299713 10:4840600-4840622 CCTCATTCCTTCCCATCCCTGTG 0: 1
1: 1
2: 9
3: 72
4: 620
Right 1063299723 10:4840637-4840659 CAGCCACATGAAGCTGCTGTGGG No data
1063299712_1063299723 21 Left 1063299712 10:4840593-4840615 CCTCTGGCCTCATTCCTTCCCAT 0: 1
1: 0
2: 5
3: 45
4: 500
Right 1063299723 10:4840637-4840659 CAGCCACATGAAGCTGCTGTGGG No data
1063299714_1063299723 7 Left 1063299714 10:4840607-4840629 CCTTCCCATCCCTGTGAACATCC 0: 1
1: 0
2: 1
3: 23
4: 310
Right 1063299723 10:4840637-4840659 CAGCCACATGAAGCTGCTGTGGG No data
1063299711_1063299723 25 Left 1063299711 10:4840589-4840611 CCTGCCTCTGGCCTCATTCCTTC 0: 1
1: 0
2: 6
3: 69
4: 656
Right 1063299723 10:4840637-4840659 CAGCCACATGAAGCTGCTGTGGG No data
1063299716_1063299723 3 Left 1063299716 10:4840611-4840633 CCCATCCCTGTGAACATCCTGGG 0: 1
1: 0
2: 0
3: 28
4: 242
Right 1063299723 10:4840637-4840659 CAGCCACATGAAGCTGCTGTGGG No data
1063299720_1063299723 -3 Left 1063299720 10:4840617-4840639 CCTGTGAACATCCTGGGCTTCAG 0: 1
1: 0
2: 1
3: 17
4: 181
Right 1063299723 10:4840637-4840659 CAGCCACATGAAGCTGCTGTGGG No data
1063299719_1063299723 -2 Left 1063299719 10:4840616-4840638 CCCTGTGAACATCCTGGGCTTCA 0: 1
1: 0
2: 1
3: 14
4: 194
Right 1063299723 10:4840637-4840659 CAGCCACATGAAGCTGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063299723 Original CRISPR CAGCCACATGAAGCTGCTGT GGG Intronic
No off target data available for this crispr