ID: 1063301937

View in Genome Browser
Species Human (GRCh38)
Location 10:4857262-4857284
Sequence TGTTGGAGGTAAAACCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063301926_1063301937 12 Left 1063301926 10:4857227-4857249 CCCACCCAAATCTCATGTTCAAT 0: 107
1: 1247
2: 11380
3: 14347
4: 12173
Right 1063301937 10:4857262-4857284 TGTTGGAGGTAAAACCTGGTGGG No data
1063301927_1063301937 11 Left 1063301927 10:4857228-4857250 CCACCCAAATCTCATGTTCAATT 0: 110
1: 1310
2: 11509
3: 15519
4: 12146
Right 1063301937 10:4857262-4857284 TGTTGGAGGTAAAACCTGGTGGG No data
1063301925_1063301937 13 Left 1063301925 10:4857226-4857248 CCCCACCCAAATCTCATGTTCAA 0: 107
1: 1356
2: 11047
3: 14091
4: 11295
Right 1063301937 10:4857262-4857284 TGTTGGAGGTAAAACCTGGTGGG No data
1063301929_1063301937 7 Left 1063301929 10:4857232-4857254 CCAAATCTCATGTTCAATTGTAA 0: 127
1: 1524
2: 6514
3: 14957
4: 13708
Right 1063301937 10:4857262-4857284 TGTTGGAGGTAAAACCTGGTGGG No data
1063301928_1063301937 8 Left 1063301928 10:4857231-4857253 CCCAAATCTCATGTTCAATTGTA 0: 123
1: 1479
2: 11071
3: 13459
4: 8491
Right 1063301937 10:4857262-4857284 TGTTGGAGGTAAAACCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063301937 Original CRISPR TGTTGGAGGTAAAACCTGGT GGG Intergenic
No off target data available for this crispr