ID: 1063309582

View in Genome Browser
Species Human (GRCh38)
Location 10:4939713-4939735
Sequence CTCAGAATGAGTGTGTTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 2, 1: 0, 2: 1, 3: 8, 4: 206}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063309576_1063309582 29 Left 1063309576 10:4939661-4939683 CCATCAATGCAAGCATTGTGACA 0: 2
1: 0
2: 0
3: 13
4: 234
Right 1063309582 10:4939713-4939735 CTCAGAATGAGTGTGTTCACTGG 0: 2
1: 0
2: 1
3: 8
4: 206
1063309577_1063309582 -3 Left 1063309577 10:4939693-4939715 CCATTGCAACCCAGCTGTCCCTC 0: 1
1: 0
2: 1
3: 19
4: 216
Right 1063309582 10:4939713-4939735 CTCAGAATGAGTGTGTTCACTGG 0: 2
1: 0
2: 1
3: 8
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063309582 Original CRISPR CTCAGAATGAGTGTGTTCAC TGG Intronic
901943592 1:12683237-12683259 CTCAGTAGGTGTGTGTTGACTGG - Intergenic
903462497 1:23529631-23529653 TTCACAATGCGTGTGTGCACAGG - Intronic
905099455 1:35506208-35506230 CTCATAAAGAATGTGTTTACAGG + Intronic
905820300 1:40984596-40984618 TTAAGAATGAGTTTGTTGACAGG + Intronic
907719568 1:56959020-56959042 CGGAAATTGAGTGTGTTCACTGG + Intronic
909319714 1:74268697-74268719 CTCACAATGACTATGTGCACTGG - Intronic
910151511 1:84152818-84152840 CTTATCATTAGTGTGTTCACTGG + Intronic
912788309 1:112625676-112625698 CCCAGAAACATTGTGTTCACAGG + Intronic
914381764 1:147122726-147122748 CACAGATTTTGTGTGTTCACAGG + Intergenic
914907206 1:151756393-151756415 GTGAGATTCAGTGTGTTCACTGG - Intergenic
915938375 1:160102483-160102505 CTCTGAATGAGTTTGTTATCAGG - Intergenic
916012295 1:160717312-160717334 CACACATTCAGTGTGTTCACTGG - Intergenic
919319703 1:196020182-196020204 CCCTGAATGAATGTGTTCAAAGG - Intergenic
919686212 1:200486084-200486106 CTCTAAAAGAGTGTGTTGACTGG + Intergenic
921063201 1:211603676-211603698 CTCAGAATGAATCAGTTCTCAGG - Intergenic
922389523 1:225125701-225125723 CTTACCATTAGTGTGTTCACAGG + Intronic
922731178 1:227949420-227949442 CTCAGAAAGGGTATGCTCACAGG - Intergenic
923836641 1:237618150-237618172 CTCAGAATGAAAGTGTTTATAGG + Intronic
924698482 1:246425496-246425518 CTCTGCCTGAGAGTGTTCACTGG + Intronic
1063309582 10:4939713-4939735 CTCAGAATGAGTGTGTTCACTGG + Intronic
1063317716 10:5022388-5022410 CTCAGAATGAGTGTGTTCACTGG - Intronic
1063413084 10:5851787-5851809 ATCAGAATGTTTGTGTTCACAGG + Intergenic
1063719786 10:8568473-8568495 CTCAGACTGAGTGTGTGGCCCGG + Intergenic
1065559757 10:26950539-26950561 CTGATAATGAGTGAGTTCTCAGG + Intergenic
1065776294 10:29123439-29123461 CTCAGAAAGAGTGTTCTCAGAGG - Intergenic
1067758721 10:49026692-49026714 CTCAGGATGTGGGTGTTGACAGG + Intronic
1068173278 10:53422846-53422868 GTGAGAATGTGTGTTTTCACGGG + Intergenic
1068998490 10:63236810-63236832 CTCAGTATTAGTTTGTGCACAGG - Intronic
1070339067 10:75480181-75480203 GGCAGAATGAGTGTATTCAAGGG + Intronic
1071669424 10:87594391-87594413 ATCAGAATATGTTTGTTCACTGG + Intergenic
1072337958 10:94416832-94416854 GTTAGAATGAGTGTGATGACAGG + Intronic
1074350576 10:112733003-112733025 CTAGGAAGGAGTGTGTCCACTGG + Intronic
1076172409 10:128332580-128332602 CTTATCATGTGTGTGTTCACTGG - Intergenic
1076393239 10:130119585-130119607 GCCAAAATGAGTGTGTTCATTGG - Intergenic
1076768979 10:132652793-132652815 CTCAGAACGAGCGTGTTGTCGGG + Intronic
1078398921 11:11006783-11006805 CTCATCATTTGTGTGTTCACTGG + Intergenic
1079272489 11:19001360-19001382 CTCATAATTCATGTGTTCACTGG - Intergenic
1079982027 11:27161300-27161322 CACGGAATGAGAGTGTTTACTGG - Intergenic
1080695652 11:34600966-34600988 ATCAAACTGAGTTTGTTCACTGG + Intergenic
1080842663 11:35999164-35999186 GGCAGAATGTGTGTGTTCATGGG + Intronic
1081017978 11:37907008-37907030 AGCAGGATGAGTGTGTTCATGGG - Intergenic
1081652862 11:44836257-44836279 ATCAGCATCTGTGTGTTCACTGG - Intronic
1084369252 11:68728242-68728264 CTTATAATTTGTGTGTTCACTGG - Intronic
1084488839 11:69467104-69467126 CTGAGAGTGGGTGTGGTCACGGG - Intergenic
1086620024 11:88876448-88876470 CTTATAATTTGTGTGTTCACTGG + Intronic
1087603329 11:100343520-100343542 CTCAGAACGCGGGTTTTCACAGG + Intronic
1088672257 11:112153792-112153814 ATCAGACTTAGTGTGTTCTCAGG + Intronic
1089075222 11:115733297-115733319 CTCAGAATGAGTGCTATGACTGG + Intergenic
1089624776 11:119744356-119744378 CTCAGCACTAGTGTGTTCAGGGG + Intergenic
1089744336 11:120606525-120606547 GACGGAATGAGTGTGCTCACAGG - Intronic
1092147098 12:6222264-6222286 GACAGAATGACTGAGTTCACCGG - Intronic
1093971216 12:25377738-25377760 CTCAGAAAGAATGTCTTCTCTGG + Intergenic
1095611112 12:44129114-44129136 CTCAGCATGAGTGTTGTCCCTGG + Intronic
1095933654 12:47654075-47654097 ATCATCATGAATGTGTTCACTGG + Intergenic
1098075176 12:66722075-66722097 CTTATAATTAGTGTGTTCATTGG + Intronic
1098315582 12:69189248-69189270 CTTAGAAAGAATGTTTTCACTGG - Intergenic
1098800625 12:74953014-74953036 CTTATAATTTGTGTGTTCACTGG + Intergenic
1100949129 12:99825764-99825786 CTCAGAAGGAGTGTGTTAACAGG - Intronic
1101157838 12:101944347-101944369 CTCAGAATCTGTCTTTTCACAGG + Intronic
1104422304 12:128646276-128646298 TTCAATATGAGTGTGTTCACTGG + Intronic
1106127852 13:26915114-26915136 AACAGAATGAGAGTGTGCACAGG - Intergenic
1109084961 13:57958902-57958924 CTTACAATGAGCATGTTCACTGG - Intergenic
1111416058 13:87945933-87945955 TTGAAAATGTGTGTGTTCACTGG + Intergenic
1111554309 13:89860328-89860350 CTCAGACTCAGTGTGTTTAAAGG - Intergenic
1111839968 13:93437455-93437477 CTTATCATGTGTGTGTTCACTGG - Intronic
1112278968 13:98046107-98046129 CTCAGAATCAGTAAATTCACAGG + Intergenic
1112566111 13:100552481-100552503 CTCAGAATGGTTGTGTTTGCTGG - Intronic
1113558450 13:111257231-111257253 CTAAGAATTGGTATGTTCACTGG - Intronic
1116648208 14:47557182-47557204 CCCAGAATGACTGTGTTTCCTGG + Intronic
1116751933 14:48897341-48897363 ATCAGCAAGATTGTGTTCACTGG + Intergenic
1117649851 14:57892257-57892279 CTCAGATTAAATGTGTACACTGG + Intronic
1118456748 14:65951813-65951835 CTCAGGCTGAGGATGTTCACAGG + Intergenic
1119370714 14:74139402-74139424 CTCAGAATTAGTGATTTTACAGG + Intronic
1121514918 14:94543167-94543189 CTCTGAGTGTGTGTGTTCACAGG + Intergenic
1124048332 15:26171998-26172020 CTCAGTTTGAGTGTGTTGATGGG - Intergenic
1125260101 15:37813837-37813859 CTCACAATTAGTATTTTCACTGG + Intergenic
1125367475 15:38933298-38933320 CTTACAATTCGTGTGTTCACTGG + Intergenic
1130651748 15:85766053-85766075 CTAAGAATGACTGCCTTCACTGG + Intronic
1130758481 15:86792121-86792143 TTCAGAATAAGTGTGGGCACTGG - Intronic
1136154850 16:28375722-28375744 CTCAGAGTGGGCGTGTTCCCTGG + Intergenic
1136208242 16:28739536-28739558 CTCAGAGTGGGCGTGTTCCCTGG - Intergenic
1136264326 16:29106173-29106195 CTCAGAGTGGGCGTGTTCCCTGG - Intergenic
1136865520 16:33749164-33749186 CTCAGAATGACTGTCTTAAAAGG + Intergenic
1137556255 16:49472323-49472345 CTTAGAATGTGTGTGTTCAGTGG - Intergenic
1139077688 16:63473368-63473390 CTCAGAAGGAGTGAATTCAATGG - Intergenic
1141927026 16:87176825-87176847 CTCTGAATGTCTGTCTTCACTGG - Intronic
1203106630 16_KI270728v1_random:1366948-1366970 CTCAGAATGACTGTCTTAAAAGG - Intergenic
1203126884 16_KI270728v1_random:1595420-1595442 CTCAGAATGACTGTCTTAAAAGG + Intergenic
1142744088 17:1946684-1946706 CTGTGAATGTGTGTGTGCACGGG + Intronic
1144131714 17:12252953-12252975 CTCAGAATCAGTTTTCTCACTGG - Intergenic
1144764946 17:17727511-17727533 CCCCGACTGGGTGTGTTCACGGG + Intronic
1151136792 17:71954350-71954372 CTGATAATGAGTGAGTTCTCAGG - Intergenic
1151371435 17:73648624-73648646 CTCAGAGTGAGGCTGTTCTCAGG + Intergenic
1152558464 17:81066315-81066337 CTCAGAATGAGGATGTTAGCTGG + Intronic
1154000942 18:10481990-10482012 TCCAGAATGAGTGTTTTCAGAGG - Intronic
1154287827 18:13076591-13076613 CTTATAATGAGTGTTTTCAAAGG + Intronic
1155943080 18:31819283-31819305 GTGAGAGTGAGTGAGTTCACGGG + Intergenic
1156284027 18:35673069-35673091 CTCTGAATGAGAGTGTACAGAGG + Intronic
1156605843 18:38666179-38666201 TTCAGAATAATTGTTTTCACTGG + Intergenic
1156997649 18:43486589-43486611 AGCAGAATGAGTGCGTTCATGGG + Intergenic
1157589570 18:48828346-48828368 TTCAGAATGCATGTGCTCACGGG + Intronic
1159787586 18:72732698-72732720 CTCAAATTTAGTGTGTTCAATGG + Intergenic
1159840349 18:73392073-73392095 GTCAAAATGAGTGTTTTCATGGG + Intergenic
1160090101 18:75818949-75818971 CAAAGAATGAGTGTGAGCACAGG + Intergenic
1160450214 18:78957621-78957643 CTGATAATGAGTGAGTTCTCTGG + Intergenic
1161170686 19:2810979-2811001 CCCAGGAGGAGTGTGTTCCCTGG + Intronic
1162264823 19:9563160-9563182 CTTATTATGTGTGTGTTCACTGG - Intronic
1165774784 19:38398063-38398085 CTCAGAAGAAGTGTGTGCAATGG + Intergenic
1165787334 19:38469491-38469513 CTCATAGTGAGGGTGTTCAAGGG - Exonic
1168210928 19:54889462-54889484 GTCAGCAAGACTGTGTTCACGGG - Intronic
1168565466 19:57418689-57418711 CTCAGAAGGGGTGTGATGACAGG + Intronic
925153036 2:1629159-1629181 TTCATCATTAGTGTGTTCACTGG - Intergenic
926861992 2:17319703-17319725 CTCAGAATGAACGTGGTCTCTGG + Intergenic
927299029 2:21489264-21489286 CTCATCATTCGTGTGTTCACTGG + Intergenic
929060259 2:37916781-37916803 CTCAGGATGTGTATGTCCACTGG - Intergenic
929138778 2:38649430-38649452 CTCAGATTCAGTGTCTTCCCTGG - Intergenic
929413388 2:41722531-41722553 CTCAGAATGAGGGGTTTCCCTGG + Intergenic
930731042 2:54728303-54728325 CAGAGGATGAATGTGTTCACAGG - Intronic
934490551 2:94759669-94759691 CTCAGAGCTAGTGTGTTCAGGGG - Intergenic
937493700 2:122396371-122396393 CTGTGAATGAGTGTGTAGACAGG - Intergenic
937767057 2:125673785-125673807 CTTATCATGTGTGTGTTCACTGG - Intergenic
939202170 2:139051201-139051223 CTGGGAATGAGTGGGTTCTCAGG - Intergenic
941179767 2:162244953-162244975 CTCAGATTGATTGTCTTCTCTGG + Intronic
945742706 2:213682592-213682614 CTCAGAATGTTTCTGTGCACAGG + Intronic
948830795 2:240597422-240597444 CTCAGAATGACTGTGTCCCAAGG + Intronic
1171880364 20:30614078-30614100 CTCAGAGCTAGTGTGTTCAGAGG - Intergenic
1173263126 20:41453953-41453975 TTCAGGATGAGTGTCTTCTCAGG - Intronic
1174944297 20:54967884-54967906 TTCAGAATGTGAGTGTTGACAGG - Intergenic
1179894224 21:44352298-44352320 CTCGGAATGAGTGTGGCCAAGGG + Intronic
1181160437 22:20957026-20957048 CACAGAATGAAGGGGTTCACTGG - Intergenic
1181790447 22:25261587-25261609 CTGAGAAGAACTGTGTTCACAGG + Intergenic
1181826249 22:25518628-25518650 CTGAGAAGAACTGTGTTCACAGG + Intergenic
1184750759 22:46485095-46485117 CTAAAACTGAGTGTTTTCACGGG - Intronic
953494399 3:43373691-43373713 GTCAGAATGAGTGTGTGCCTGGG - Intronic
954745088 3:52783170-52783192 CTCAGAATGAGGGCATACACTGG + Intronic
955870094 3:63428958-63428980 CATAGAATGAGTGTGGACACAGG + Intronic
958065379 3:88538645-88538667 TTGTGAATGTGTGTGTTCACTGG + Intergenic
959238515 3:103757021-103757043 CTTATAATGCGTGTCTTCACTGG + Intergenic
959354983 3:105314727-105314749 CTCAGAATGTGACTGTTCATAGG - Intergenic
960143215 3:114171496-114171518 CTGAGAATGATTCTGTTCATGGG - Intronic
960323376 3:116264988-116265010 CTCAGGATGAGGCTGCTCACAGG - Intronic
960531730 3:118772948-118772970 CAGAAAATGAGTGTGTTCAAAGG + Intergenic
965119969 3:164541683-164541705 CTCACAGTGAGTGAGTTCATGGG + Intergenic
967865876 3:194189305-194189327 GTCAGAATCTGTATGTTCACAGG + Intergenic
969577707 4:8046253-8046275 CACAGAAGGAGTGTGTCCGCAGG - Intronic
972497498 4:39647571-39647593 TTCAGAATGGGTTTGTTCCCTGG - Intergenic
974900512 4:67991245-67991267 TTAAGAATGTGTGGGTTCACTGG - Intergenic
975091827 4:70412733-70412755 TTCAGAATGAAACTGTTCACAGG - Intergenic
978134062 4:105235381-105235403 CTCAGAATAATTGTGTGAACAGG + Exonic
983583772 4:169334830-169334852 CACAGAATGAATGTGTTAAGAGG + Intergenic
984565773 4:181328496-181328518 CTCATAGTGAGGGTGTTCTCAGG + Intergenic
984605776 4:181784637-181784659 CTCAAAAAAAGTGTTTTCACGGG + Intergenic
988706138 5:33727689-33727711 CTAAGAAAGAGTGTGTTCCAGGG - Intronic
990003006 5:50916972-50916994 CTCATCATTAGTGTGTTCACTGG + Intergenic
990886695 5:60602442-60602464 CTCAGAAGGAGGCAGTTCACTGG + Intronic
992349652 5:75916124-75916146 CACTGAATGATTGTGTTGACTGG - Intergenic
993349208 5:86825974-86825996 CTCCAAATTAGTCTGTTCACGGG - Intergenic
993787338 5:92159537-92159559 CTCATCATTTGTGTGTTCACTGG - Intergenic
996957721 5:129204749-129204771 CTGTGAATCAGTCTGTTCACAGG + Intergenic
1001885827 5:175289398-175289420 CTGATAATGAGTGAGTTCTCTGG - Intergenic
1003829664 6:9993838-9993860 CTGAGAACCAGGGTGTTCACTGG - Intronic
1004425153 6:15502155-15502177 CTCAGGATGAGTGTGCTGCCGGG - Intronic
1008197656 6:48544422-48544444 CTCTGTGTGTGTGTGTTCACTGG + Intergenic
1008761191 6:54852754-54852776 CTCATGATGTGTGTGTTTACTGG - Intronic
1009032800 6:58080979-58081001 ATCAGACTGACTGTGTCCACTGG - Intergenic
1009208416 6:60832753-60832775 ATCAGACTGACTGTGTCCACTGG - Intergenic
1010296168 6:74199238-74199260 CACACAATGGTTGTGTTCACAGG - Intergenic
1010848500 6:80742995-80743017 CTCAGAATGATTATGTTCATGGG - Intergenic
1012356988 6:98326626-98326648 ATCAGAAAGAGTTTCTTCACTGG - Intergenic
1013610708 6:111792420-111792442 CACAGGATGTGTGTGTTCAATGG - Intronic
1015457543 6:133444671-133444693 CTCAGAAAGAGTGTGCTCTTGGG + Intronic
1015624874 6:135170507-135170529 CTCAGAATGAGTGAGATATCTGG + Intergenic
1019125060 6:169832870-169832892 CTCAGCATGAGTGCCTTCTCAGG + Intergenic
1020318504 7:6923998-6924020 CCCTGGATGAGTGTGTTCCCAGG - Intergenic
1022992561 7:35722845-35722867 CTCAGAGTGAGTGAGCTCTCTGG + Intergenic
1026590356 7:71689378-71689400 CTTAGCATTCGTGTGTTCACTGG - Intronic
1028342444 7:89738203-89738225 CACAGTCTGAGTGTGTTTACCGG - Intergenic
1028933688 7:96442340-96442362 CTAAGTATGAGTGTGTTTACCGG - Intergenic
1030931458 7:115527961-115527983 CACAGAATGAGGTTGTTCTCTGG - Intergenic
1031236773 7:119187618-119187640 CTCAGAAGGAGTATCTTGACAGG - Intergenic
1031838812 7:126711980-126712002 CTCATCATTTGTGTGTTCACTGG + Intronic
1032927809 7:136629036-136629058 CTCACCATTTGTGTGTTCACTGG - Intergenic
1033082535 7:138311761-138311783 CACAAAATGAGAGTGTTGACAGG - Intergenic
1035332194 7:158103569-158103591 CTCAGAATGTCTGAGGTCACTGG + Intronic
1036384945 8:8270633-8270655 CACAGACTGAGTGTGTACTCTGG + Intergenic
1039362765 8:36897988-36898010 CTCAGGATGCCTGTATTCACAGG + Intronic
1040737263 8:50523268-50523290 TTCAAAATGCATGTGTTCACTGG + Intronic
1046006033 8:108485672-108485694 TTCAAAATGAGTTTGTTAACTGG - Intronic
1046130339 8:109959859-109959881 CTTATCATGTGTGTGTTCACAGG - Intergenic
1046352091 8:113028578-113028600 CTTATAATTTGTGTGTTCACTGG - Intronic
1049094319 8:140539562-140539584 GAGACAATGAGTGTGTTCACGGG + Intronic
1050576704 9:7004075-7004097 AGCAGAATGAGTGTGATGACTGG + Intronic
1051534650 9:18143186-18143208 CTTAAAATGAGTGTGTCCTCTGG - Intergenic
1052591892 9:30507804-30507826 CTTATCATTAGTGTGTTCACTGG + Intergenic
1055942761 9:81666114-81666136 TTCAGAAAGAGCCTGTTCACAGG + Intronic
1059290078 9:113215095-113215117 CTCATCATTTGTGTGTTCACTGG + Intronic
1060362683 9:122974910-122974932 CACAGAATGAGTGTGTAAGCAGG + Intronic
1061842291 9:133366222-133366244 CTCAGAATCACTTTGTTCTCTGG - Intronic
1062447374 9:136600682-136600704 CTGAGGAGGAGTGTGTGCACTGG + Intergenic
1186787628 X:12968423-12968445 ATCAGTCTGAGTGTGTACACAGG - Intergenic
1186877877 X:13834752-13834774 CTGAGAATGAGTGGGATCTCAGG - Intronic
1188447904 X:30275979-30276001 CTGATAATGAGTCTTTTCACAGG - Intergenic
1189947982 X:46199639-46199661 CTCAGAATTAGTATTTTGACTGG + Intergenic
1191103355 X:56757415-56757437 CCCAGAATTAGTGTGTTTAGTGG - Intergenic
1193753162 X:85372438-85372460 CTCAGATTTAGTGTGTACAAAGG - Intronic
1194997618 X:100608917-100608939 CTCAGAATGAATGTGTTGTAGGG - Intergenic
1195500686 X:105594998-105595020 CTCAGAATGAGTGTGTTACATGG - Intronic
1198142689 X:133820916-133820938 CTCAAACTGACTGTGTTCAAAGG + Intronic
1198535237 X:137579143-137579165 CTAAGAATAAGTGTTTTCATTGG - Intergenic
1199058563 X:143327018-143327040 CTCAGAAAGGGTGCATTCACTGG + Intergenic
1199246321 X:145609218-145609240 TTCACAAGGAGTGTGTCCACAGG - Intergenic
1199354955 X:146851254-146851276 GCCATAATGAGTGAGTTCACTGG - Intergenic
1199602616 X:149551311-149551333 CTCAGAGTGTGTGTGTCTACAGG - Intergenic
1199647772 X:149928164-149928186 CTCAGAGTGTGTGTGTCTACAGG + Intergenic
1201934937 Y:19400002-19400024 CTCAGAACTAGAGTATTCACAGG + Intergenic
1202586463 Y:26433438-26433460 CTCAGAATGACTGTCTTAAAAGG - Intergenic
1202622026 Y:56824109-56824131 CTCAGAATGACTGTCTTAAAAGG + Intergenic