ID: 1063309881

View in Genome Browser
Species Human (GRCh38)
Location 10:4942182-4942204
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 2, 1: 0, 2: 0, 3: 5, 4: 68}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063309881 Original CRISPR ATGCTCCATAGTTACATGGC AGG (reversed) Intronic
901318044 1:8322148-8322170 TGGGTCCATAGTTACATGGATGG + Intronic
904480599 1:30791019-30791041 ATGCCCCAGAGTTCCACGGCCGG + Intergenic
904837420 1:33348450-33348472 ATGCTCCAGAGCCAAATGGCTGG + Intronic
911543610 1:99188726-99188748 ATGCTCCAGAGTTGAATTGCTGG + Intergenic
915573990 1:156763014-156763036 ATGCACCATAGGTAATTGGCTGG - Intronic
915744314 1:158144398-158144420 ATGCTCCATAAACAAATGGCTGG - Intergenic
919356641 1:196532923-196532945 ATGCTCCAGATTTACATGAGTGG - Intronic
919384003 1:196896614-196896636 ACGCTCCTTAGCCACATGGCAGG - Intronic
922203459 1:223426481-223426503 ATGATCCATGCTTCCATGGCAGG + Intergenic
1063309881 10:4942182-4942204 ATGCTCCATAGTTACATGGCAGG - Intronic
1063317413 10:5019916-5019938 ATGCTCCATAGTTACATGGCAGG + Intronic
1065540262 10:26758164-26758186 ATTCTCCATATTTACATAGGAGG - Intronic
1068387136 10:56345343-56345365 ATGCTCCAAAGTGAAATTGCTGG - Intergenic
1069289464 10:66759698-66759720 GTGCTCAATAGCCACATGGCTGG - Intronic
1074240779 10:111637049-111637071 ATGCTCCATAGTGCCCTGGAGGG + Intergenic
1089530145 11:119122509-119122531 TTGCTCCTTAGTTCTATGGCTGG - Intronic
1093760570 12:22904518-22904540 ATGCTCCACAGATACAAGGAGGG - Intergenic
1103568090 12:121827113-121827135 ATGCTCCAAAGGTTAATGGCTGG + Intronic
1111970979 13:94916336-94916358 ATGCTCTAGAATAACATGGCTGG - Intergenic
1113691948 13:112317308-112317330 ATGGTCCACGCTTACATGGCAGG - Intergenic
1113865931 13:113524048-113524070 ATGCTCCAAAGTCACTTGGGAGG + Intronic
1117341177 14:54793224-54793246 ATGATTCTTAGTTACATGGGAGG - Exonic
1120093728 14:80364276-80364298 ATCCACCATATTGACATGGCAGG - Intronic
1121982722 14:98468730-98468752 AGGCTACATACTTACATGACTGG - Intergenic
1125825943 15:42676555-42676577 ATGTTTCATAGTTACAATGCAGG - Intronic
1127066121 15:55240670-55240692 ATTTTCCAAAGTTACATGACTGG - Intronic
1129250639 15:74307032-74307054 CTGCTCCTTAGTGAGATGGCCGG + Intronic
1132861128 16:2072354-2072376 CTGCTCCATGGTACCATGGCCGG + Exonic
1134772810 16:16824776-16824798 ATGCTCTAAAGTCACATAGCTGG + Intergenic
1135755200 16:25091554-25091576 TTGCTCCCTAGTTCCATGGCAGG - Intergenic
1136118366 16:28110929-28110951 ATGCTTCATGGTTACATAGCTGG - Intronic
1149377145 17:56055735-56055757 ATACTCAATAGTTAGATTGCTGG + Intergenic
928325631 2:30317373-30317395 CTGCTCCATAAGTTCATGGCTGG - Intronic
930396782 2:50831723-50831745 ATGCTCTCTTGTTACAAGGCTGG - Intronic
937100080 2:119261894-119261916 AAGCTCCATTGTAAAATGGCCGG + Intronic
939362568 2:141192031-141192053 ATGCTTCAAAGTTGCATGACTGG - Intronic
941199468 2:162491139-162491161 AGGCTCCACAGGTTCATGGCAGG - Intronic
943210975 2:184965500-184965522 ATGTCATATAGTTACATGGCTGG + Intergenic
947813507 2:233020763-233020785 GTGCTTCCTATTTACATGGCAGG - Intergenic
1170380084 20:15748908-15748930 CTTGTCCAAAGTTACATGGCTGG - Intronic
1171571888 20:26260237-26260259 ATACTCCATAATGAGATGGCTGG + Intergenic
1173737662 20:45373247-45373269 CTGCTCCAGGGTGACATGGCAGG - Exonic
1178762990 21:35421892-35421914 AAGCTCCAGAGTAACATGCCAGG + Intronic
1178816809 21:35938105-35938127 TAGCACCAGAGTTACATGGCTGG - Intronic
950929667 3:16775608-16775630 ATGCTGCAGATTTACATGGGAGG - Intergenic
965398996 3:168195540-168195562 ATTCATCATTGTTACATGGCAGG - Intergenic
969447603 4:7254154-7254176 ATGCTCAATAGTAGCATTGCTGG - Intronic
972827254 4:42773598-42773620 ATACTCCATAGTGAAATTGCTGG - Intergenic
982478116 4:155877642-155877664 AGGCTCCATGGTTGCATGGCAGG + Intronic
986234320 5:5893266-5893288 ATGGTCCTTTGTTTCATGGCAGG + Intergenic
988793298 5:34628966-34628988 TTGCTCCATAAGTAGATGGCAGG + Intergenic
992719506 5:79546515-79546537 GTGCTCCATAGTTACATGTGTGG - Intergenic
995746284 5:115407306-115407328 AGGTTCCATAGTTCCATGTCAGG - Intergenic
999747899 5:154606132-154606154 AGGATCCATAATTGCATGGCTGG + Intergenic
1002909856 6:1481493-1481515 GTGCTCCATAGCTCCAGGGCTGG - Intergenic
1004079663 6:12379807-12379829 ATGCTCCATCCTGACATGGCAGG + Intergenic
1004343237 6:14825936-14825958 AGGCTCAATAGAGACATGGCAGG + Intergenic
1006283421 6:33075322-33075344 AAGCTGCATATTTACATGGTAGG + Intronic
1011397043 6:86920962-86920984 ATGGTCCAGAGTCACATGCCTGG - Intergenic
1014962449 6:127703969-127703991 TTGCTGCATCCTTACATGGCAGG + Intergenic
1018356860 6:163026987-163027009 ATGCTCCATATGAACATGGAAGG + Intronic
1027649601 7:80850079-80850101 CTACTCTATAGTTACATGACCGG + Intronic
1027671153 7:81101126-81101148 ATGCTGTTTAATTACATGGCTGG + Intergenic
1034395462 7:150821082-150821104 AGGCCCCAGAGTTACAGGGCAGG + Intergenic
1034542679 7:151768998-151769020 ATGCTCCAAAGCTCCATGGAGGG + Intronic
1035452488 7:158986921-158986943 ATGATGCATAGGTACATGGATGG - Intergenic
1036771343 8:11580295-11580317 CTGCTCCACAGTCACACGGCTGG - Intergenic
1038122218 8:24630072-24630094 ATGCCCCATTGTTTCTTGGCTGG + Intergenic
1042958828 8:74280812-74280834 ATGCTCCGTAATTGCAAGGCAGG - Intronic
1044592973 8:93931822-93931844 ATGTGCCATAGTGACAAGGCAGG + Intergenic
1046569184 8:115941390-115941412 CTACTTCATAGGTACATGGCTGG + Intergenic
1048740370 8:137551933-137551955 ATGCTCCACACTTCCATGGGAGG - Intergenic
1057411667 9:94821662-94821684 ATGCTCTAGAATTACATGTCAGG - Intronic
1058269527 9:102953012-102953034 ATACTCCATAGTAAGATTGCTGG - Intergenic
1196818833 X:119686713-119686735 ATAATCCATCATTACATGGCTGG + Intronic